Molecular Cancer Therapeutics  AM No Date
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, D.
Right arrow Articles by Kelley, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, D.
Right arrow Articles by Kelley, M. R.
Mol Cancer Ther. 2004;3:679-686
© 2004 American Association for Cancer Research

Human apurinic endonuclease 1 (APE1) expression and prognostic significance in osteosarcoma: Enhanced sensitivity of osteosarcoma to DNA damaging agents using silencing RNA APE1 expression inhibition

Dong Wang, Meihua Luo and Mark R. Kelley

Section of Hematology/Oncology, Department of Pediatrics, Herman B Wells Center for Pediatric Research, Indianapolis, Indiana; and Departments of Biochemistry & Molecular Biology and Pharmacology & Toxicology, Indiana University School of Medicine, Indianapolis, Indiana

Requests for reprints: Mark R. Kelley, Department of Pediatrics, Herman B Wells Center for Pediatric Research, 1044 W. Walnut, R4-302C, Indianapolis, IN 46202. Phone: 317-274-2755; Fax: 317-278-9298. E-mail: mkelley{at}iupui.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Cell Culture
 Results
 Discussion
 References
 
Osteosarcoma is the most common highly malignant bone tumor with primary appearance during the second and third decade of life. It is associated with a high risk of relapse, possibly resulting from a developed resistance to chemotherapy agents. As a means to overcome osteosarcoma tumor cell resistance and/or to sensitize tumor cells to currently used chemotherapeutic treatments, we examined the role of human apurinic endonuclease 1 (APE1) in osteosarcoma tumor cell resistance and prognosis. Sixty human samples of archived conventional (intramedullary) osteosarcoma were analyzed. APE1 protein was elevated in 72% of these tissues and among those with a known clinical outcome, there was a significant correlation between high APE1 expression levels and reduced survival times. The remaining 28% of samples showed low expression of APE1. Given that APE1 was overexpressed in osteosarcoma, we decreased APE1 levels using silencing RNA (siRNA) targeting technology in the osteosarcoma cell line, human osteogenic sarcoma (HOS), to enhance chemo- and radiation sensitivity. Using siRNA targeted technology of APE1, protein levels were reduced by more than 90% within 24 hours, remained low for 72 hours, and returned to normal levels at 96 hours. There was also a clear loss of APE1 endonuclease activity following APE1-siRNA treatment. A decrease in APE1 levels in siRNA-treated human osteogenic sarcoma cells led to enhanced cell sensitization to the DNA damaging agents: methyl methanesulfonate, H2O2, ionizing radiation, and chemotherapeutic agents. The findings presented here have both prognostic and therapeutic implications for treating osteosarcoma. The APE1-siRNA results demonstrate the feasibility for the therapeutic modulation of APE1 using a variety of molecules and approaches.

Key Words: APE1/ref-1 • siRNA • base excision repair • translational • osteosarcoma


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Cell Culture
 Results
 Discussion
 References
 
Osteosarcoma, although not a common cancer in the United States, is among the most common non-hematologic primary malignant tumors of adults and children (1). The peak incidence of osteosarcoma usually occurs in the second and third decade of life, and approximately 1,000 new cases a year are diagnosed (1). Although an increased number of molecular studies have been initiated in recent years, no clear results or new therapeutic treatments have been obtained (1). Standard chemotherapeutic treatments for osteosarcoma include high-dose methotrexate, platinum compounds, and doxorubicin and more recently the alkylators: ifosfamide, melphalan, and cyclophosphamide (2). One goal of our ongoing studies is to not only identify prognostic DNA repair factors in osteosarcoma and other cancers, but to also identify new therapeutic protocols that can increase tumor cell killing with reduced toxicity using DNA repair enzymes and pathways as targets (3).

Cellular DNA is constantly exposed to a wide spectrum of exogenous and endogenous factors that generate DNA lesions. This is particularly true when patients are treated with chemotherapeutic agents. To counteract this challenge, a variety of DNA repair pathways have evolved, protecting cells against the genotoxic effects of DNA damage. Cells repair DNA damage via four main mechanisms: direct reversal, base excision repair, nucleotide excision repair, and mismatch repair. The damage induced by alkylators and oxidative damage is effectively repaired by base excision repair and within the base excision repair pathway, one of the main enzymes in this pathway is human apurinic endonuclease 1 (APE1; ref. 4). APE1 is abundant in human cells and accounts for nearly all of the abasic site cleavage activity observed in cellular extracts (5). APE1 possesses a strong, Mg2+-dependent endonuclease activity that hydrolyzes the phosphodiester bond 5' to potentially cytotoxic abasic sites, leaving a 3'-OH and 5'-deoxyribose phosphate (6). In addition, APE1 has a 3'-phosphodiesterase activity that excises deoxyribose fragments and phosphate groups at the 3' terminus of strand breaks caused by ionizing radiation, yielding a 3'-OH substrate for polymerase B repair synthesis (7). APE1 has recently been shown to possess a 3' mismatch exonuclease activity as well (8, 9).

In addition to its DNA repair functions, APE1 is also a multifunctional protein that participates in other crucial cellular processes, including the response to oxidative stress, regulation of transcription factors, cell cycle control, and apoptosis (4). It was independently determined to be a reduction-oxidation effector factor and given the alternative name of ref-1 (10). As the reduction-oxidation factor, APE1/ref-1 can reduce a conserved cysteine residue in members of the Jun/Fos and related activating transcription factor/cAMP-responsive element binding protein families of proteins, facilitating formation of hetero- and homodimers that bind to transcriptional regulatory elements containing activator protein 1 (AP-1) and cAMP response element motifs (10). In addition, APE1 stimulates the DNA binding of other transcription factors, including hypoxia inducible factor {alpha}, nuclear factor {kappa}B, Myb, thyroid transcription factor 1, Pax5, and Pax8 (4). APE1/ref-1 has also been implicated in regulating the transactivation and pro-apoptotic activity of p53 (11). Because of the critical role that APE1/ref-1 has in DNA repair and transcription factor regulation, and its previously altered levels of expression and function in a variety of other cancers, such as prostate, ovarian, cervical, and germ cell tumors, we have focused our attention on this key enzyme in osteosarcoma (4, 12-19). Additionally, previous studies by us have shown an elevated level of APE1 in both primary and metastatic embryonic rhabdomyosarcoma, but not alveolar rhabdomyosarcoma (13). We have extended these studies to osteosarcoma to determine levels of expression and prognostic significance. Additionally, we have been able to decrease the level of APE1 in osteosarcoma cell lines using APE1-silencing RNA (siRNA) targeting technology which gives us a window of opportunity to sensitize these tumor cells to alkylating and oxidative chemotherapeutic agents and ionizing radiation.

The findings presented here have both prognostic and therapeutic implications for treating osteosarcoma and also are the first time cells devoid of APE1 have been produced in cell lines, allowing for further investigations of the role of APE1 in tumor cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Cell Culture
 Results
 Discussion
 References
 
Tissue
Sixty samples of archived conventional (intramedullary) osteosarcoma from 1972 to 1999 were identified by the investigator only by unique patient identifiers to maintain confidentiality and were selected based on specimen availability. The study was approved by the Institutional Review Board of Indiana University School of Medicine as EX9812-05. The clinical outcome was available for 35 of the cases. Patient characteristics are detailed in Table 1.


View this table:
[in this window]
[in a new window]

 
Table 1. Patient characteristics of 60 intramedullar osteosarcoma cases

 
Immunohistochemistry and APE1 Scoring
Tissues were cut in 6-µm sections and fixed on glass slides. Slides were processed at the Indiana University School of Medicine immunohistochemistry laboratory using monoclonal antibody to APE1 (Novus Biologicals, Littleton, CO) which has been extensively characterized and previously described (12-18, 20-22). The sections were stained using a Ventana automated staining system. Ovarian tissues that had been previously used and characterized for APE1/ref-1 staining were included as positive controls (17, 23). The results were analyzed using a blinded coding system in which the staining procedures and microscopic assessments were done without knowledge of the histopathologic diagnosis and follow-up.

Each specimen's histologic diagnosis was confirmed by a pathologist as previously done in other studies with APE1 (13, 15, 18, 20, 22). Tissues were scored for: (1) percentage of cell staining and (2) intensity of staining (low, moderate, or high). To be defined as having low expression, the tissue needed to have weak staining and positive cell percentage less then 50% or moderate staining and positive percentage less then 25%.


    Cell Culture
 Top
 Abstract
 Introduction
 Materials and Methods
 Cell Culture
 Results
 Discussion
 References
 
The human osteogenic sarcoma (HOS) cells were purchased from American Type Culture Collection (Manassas, VA) and grown in MEM{alpha} (Life Technologies, Inc., Grand Island, NY) supplemented with 10% fetal bovine serum, 2 mmol/L L-glutamine, 0.1 mmol/L nonessential amino acid, 1.0 mmol/L pyruvate, and 100 units/mL penicillin-100 µg/mL streptomycin. The cells were maintained in a humidified incubator at 37°C in an atmosphere of 5% CO2 and 95% air.

Drugs, Ionizing Radiation Treatments, and Cell Survival Assays
HOS cells were treated with 0.25% trypsin-EDTA (Life Technologies) and counted. Two thousand cells or media alone were aliquoted into each well of a 96-well plate in triplicate and allowed to adhere overnight. Methyl methanesulfonate (MMS; Sigma-Aldrich, St. Louis, MO) was added to a final concentration of 0, 0.0063, 0.0125, 0.05, and 0.1 mmol/L. H2O2 (Sigma-Aldrich) was added to a final concentration of 0, 0.0016, 0.0032, 0.0063, 0.0125, and 0.025 mmol/L for 1 hour incubation, then washed with PBS and fresh medium added. After 72 hours, 0.05 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was added and incubated at 37°C for 4 hours, the medium was then removed, and 100 µL DMSO and ethanol (1:1 ratio) were added followed by absorbance measurement at 570 nm. The values were standardized to media-alone wells.

For ionizing radiation experiments, cells were plated for 12 hours in a six-well plate and grown to 70% confluence. Irradiation was done using a Co-60 {gamma} unit (Nordion International, Kanata, Canada) with different doses at room temperature. After irradiation, the cells were immediately trypsinized, counted, and 2,000 cells/well were aliquoted into each well of a 96-well plate in triplicate. Cell viability was detected using the MTT assay after 72 hours.

Apoptosis Assays Using Fluorescein-Conjugated Annexin-V (Annexin-V-FITC)/Propidium Iodide Staining
To analyze the cells for apoptosis, ~600,000 cells were plated and allowed to attach overnight. Cells were treated with the drug for ~48 hours and then assayed for apoptosis after 48 hours using Annexin-V-FITC staining (24). The cells were trypsinized, pelleted, washed in DPBS, and resuspended in 1x binding buffer [10 mmol/L HEPES/NaOH (pH 7.4), 140 mmol/L NaCl, 2.5 mmol/L CaCl2] containing Annexin-V-FITC antibody (PharMingen, San Diego, CA) and propidium iodide (PI) according to the manufacturer's indicated protocol. The samples were analyzed by flow cytometry either in the HB Wells Center or in the Indiana University Cancer Center flow cytometry facility.

APE1 siRNAs
siRNAs used to decrease apurinic endonuclease in cells were obtained from Dharmacon Research, Inc. (Lafayette, CO), deprotected and hybridized according to directions of the manufacturer (25-28). Sequences of the double-stranded siRNAs are antisense (5' GUCUGGUACGACUGGAGUACC 3', 5' UACUCCAGUCGUACCAGACCU 3') and nonsense (5' CCAUGAGGUCAGCAUGGUCUG 3', 5' GACCAUGCUGACCUCAUGGAA 3'). Scrambled (Sc) APE1 siRNAs were used as negative controls. Unpurified siRNAs complexed with Oligofectamine in Optimem I (Invitrogen Corp., Carlsbad, CA) according to directions of the manufacturer were applied to HOS cells 30% confluent in Optimem I on six-well polylysine-coated plates (Biocoat, BD Biosciences, San Jose, CA) to give final concentrations of 50 or 200 nmol/L. Following a 6-hour incubation at 37°C, 0.5 volume of DMEM + 30% fetal calf serum was added to each well. Twelve hours later, the medium was replaced with DMEM + 10% serum and incubation was continued until completion of the treatment.

Apurinic Endonuclease Assay
HOS cells were harvested by trypsinization and suspended in serum-containing culture medium, then centrifuged at 1500 x g for 5 minutes. The cells were washed with 5 to 10 mL of PBS, recentrifuged, then resuspended in 0.5 mL PBS with 2 mmol/L DTT, and kept on ice. The cells were pulse-sonicated on ice at 45 W, three times for 15 seconds each, then centrifuged at 14,000 x g at 4°C for 10 minutes. Protein concentration was quantitated by measuring absorbance at 595 nm using the Bio-Rad Bradford Protein Assay. Protein extract was used in the APE1 endonuclease assay on the tetrahydrofuranyl-oligonucleotide as described below (29).

The cellular protein extract (0 to 1 µg) was mixed in a total volume of 20 µL assay buffer [50 mmol/L HEPES, 50 mmol/L KCl, 10 mmol/L MgCl2, 1% bovine serum albumin, 0.05% Triton X-100 (pH 7.5)] at 37°C for 15 minutes. Included in this reaction was 0.2 pmol of the HEX-labeled tetrahydrofuranyl oligo (the 26-bp oligonucleotide substrate containing a single tetrahydrofuranyl resides in the middle, yielding a HEX-labeled 13 mer fragment on repair; ref. 29). The reactions were terminated by adding 20 µL formamide without dyes. Sample solutions (20 µL) were then applied to a 20% polyacrylamide gel containing 8 mol/L urea in 1x Tris-borate EDTA buffer at 300 V for 40 minutes.

Statistical Analysis
The relationship between APE1 expression and clinical-pathologic data was examined using {chi}2 analysis. Survival curves were plotted using the method of Kaplan-Meier, and the log-rank test was used to determine statistical difference between life expectancy. All P values were two sided, and P values <0.05 were used for significance. For the drug killing/survival studies, data were analyzed using the one-way ANOVA test with Sigma Stat software (Jandel Scientific, Erkrath, Germany).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Cell Culture
 Results
 Discussion
 References
 
Osteosarcoma Immunohistochemistry and Clinicopathologic Parameters
A total of 60 separate osteosarcoma tissue blocks was processed and analyzed for APE1 immunostaining. Tissues determined previously to express APE/ref-1 were used as positive controls and the specificity of the antibody was determined as previously published by us and others (12-18, 20-22). The antibody staining was predominantly localized in the nucleus of tumor cells, including osteoblastic, fibroblastic, chondroblastic cells, and polynuclear giant cells of some tumors. The intensity and percentage of staining was determined for each of the cases. Forty-three of 60 osteosarcoma cases (72%) were determined to demonstrate high levels of APE1 expression (Fig. 1C and D), whereas the remaining 17 (28%) showed low expression of APE1 (Fig. 1E and F). Additionally, all three cases of fibrous dysplasia showed low APE1 expression (Fig. 1A and B).



View larger version (106K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. APE1 immunohistochemical staining of osteosarcoma. H&E (A) and APE1 (B) immunohistochemistry stain of bone fibrous dysplasia demonstrating low level of expression of APE1. H&E (C) and APE1 (D) immunohistochemistry stain of osteosarcoma showing high level of expression of APE1. H&E (E) and APE1 (F) immunohistochemistry stain of osteosarcoma showing low level of expression of APE1.

 
Ape/ref-1 Immunohistochemistry Reactivity and Prognosis
In 35 of the 60 osteosarcoma cases, clinical follow-up data were available. A Kaplan-Meier survival analysis shows a significant association of high APE1 expression and poorer overall survival (P < 0.026; Fig. 2). Furthermore, APE1/ref-1 expression was not related with the age of patients, tumor location, tumor size, nor the pathologic classification (P > 0.05; Table 2).



View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Kaplan-Meier curve of overall survival of osteosarcoma patients with low and high APE1 immunohistochemistry staining.

 

View this table:
[in this window]
[in a new window]

 
Table 2. Relationship of APE1 expression and pathologic features of 60 osteosarcomas

 
APE1 siRNA Knockdown Experiments and Drug/Ionizing Radiation Treatments
HOS cells were treated with APE1-siRNA oligonucleotides and cultured for 4 days. Aliquots of cells were used each day and APE1 protein level determined using Western blot analysis and APE1 monoclonal antibody (Fig. 3). As shown in Fig. 3, APE1 levels declined in excess of 90% 24 hours after the addition of siRNA oligonucleotide, remained low for 72 hours, and returned to normal levels at 96 hours. We have also observed this pattern of decreased APE1 expression in other cell lines.2 In another series of experiments, cells were collected at 48 hours following APE1-siRNA treatment, and apurinic endonuclease assays were done. As shown in Fig. 4, there is a 95% loss of APE1 endonuclease activity following APE1-siRNA treatment showing a correlation between decreased APE1 protein levels and a loss in apurinic endonuclease repair function.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Knockdown of APE1 levels using RNA interference (siRNA). A, Western blot of HOS cells treated with APE1 siRNA. Samples were collected at 24, 48, 72, and 96 hours after APE1-siRNA treatment and Western blot analysis was done with APE1 monoclonal antibody (APE1) and reprobed with actin antibody as a loading control. Sc, scrambled control.B, normalized APE1 levels after adjusting for loading.

 


View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Apurinic endonuclease activity assay for HOS cells treated with APE1-siRNA. A, Western blot of HOS cells at 48 hours after either the scrambled control or APE1-siRNA treatment of the cells, probed with either APE1 or actin antibody. B, HOS cells assayed for APE1 activity using the same cells as treated in A and the HEX-tetrahydrofuranyl-oligonucleotide assay as described in Materials and Methods.

 
Following the initial characterization of APE1-siRNA knockdown methodology, we began a series of experiments to demonstrate that decreased APE1 levels lead to enhanced osteosarcoma cell sensitization to DNA damaging agents and ionizing radiation. HOS cells were treated with APE1-siRNA oligonucleotides and these cells were treated with an alkylating agent, MMS; oxidizing agent, H2O2; chemotherapeutic agents, thiotepa or etoposide; or ionizing radiation. Thiotepa and etoposide were used in these studies because they are currently used in clinical treatments of sarcomas (30, 31). Cell survival/killing was assessed using the MTT assay for MMS, H2O2, or thiotepa (Fig. 5A-C) or the Annexin/PI apoptosis assay for etoposide and ionizing radiation (Fig. 5D and E). Decreased levels of APE1 clearly led to enhanced cell killing to all agents analyzed. To ascertain how the cells were dying: apoptosis or necrosis, we did apoptosis assays using the Annexin-V/PI flow cytometry analysis (Fig. 6). There were two clear results of this analysis. First, increasing MMS doses in the presence of APE1-siRNA resulted in elevated Annexin-V staining and, therefore, increased apoptosis levels in those cells compared with the scrambled control-treated cells. Second, even at the 0 mmol/L MMS dose, there was an increase in apoptosis in the APE1-siRNA cells compared with the control, scrambled-treated cells (Fig. 6). Similar results were found with the other DNA damaging agents (data not shown).



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Cell survival or apoptosis levels of HOS cells treated with DNA damaging agents and APE1-siRNA. HOS cells were treated with APE1-siRNA and various DNA damaging agents and cell survival/killing was analyzed by the MTT assay (A, B, or C) or the fluorescein-conjugated Annexin-V (Annexin-V-FITC)/PI assay as described in Materials and Methods (24). HOS cells were treated with either MMS (A), H2O2 (B), thiotepa (C), etoposide (D), or irradiation (E). Cell survival/killing is plotted as either percentage of control cells following MTT in A–C or the number of cells undergoing apoptosis in panels D and E. Points, mean; bars, SE. Significant differences existed at all dose levels at the P > 0.05 level using the one-way ANOVA test with Sigma Stat software (Jandel Scientific).

 


View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Apoptosis versus necrosis assay for HOS cells treated with MMS and APE1-siRNA. Annexin-V-FITC/PI flow cytometry analysis was done using cells following treatment with APE1-siRNA and MMS as a representative DNA damaging agent. Following treatment, cells were analyzed and the number of cells undergoing apoptosis was ascertained. A, flow cytometry results of HOS cells treated with scrambled or APE1-siRNA and Annexin/PI. B, schematic of results expected using this assay to ascertain cells undergoing apoptosis only (lower right quadrant) versus those undergoing late apoptosis and necrosis (upper right quadrant). C, quantification of the data presented in panel A for cells undergoing apoptosis alone (lower right quadrant).Sc, scrambled control siRNA.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Cell Culture
 Results
 Discussion
 References
 
Osteosarcoma is the most common highly malignant bone tumor with a peak expression during the second and third decade of life (32). Due to neoadjuvant chemotherapy, the survival rate has increased to 60% to 70% within the last 20 years. Regrettably, some groups of patients remain at high risk of eventual relapse, suggesting that the chemotherapy resistance is an element contributing to the survival of the tumor and something that must be overcome to advance the treatment of this cancer (33). Although there have been numerous mechanisms proposed to explain drug resistance in osteosarcoma, for example, p-glycoprotein and multidrug resistance genes, little has been firmly established in the mechanism of osteosarcoma tumor cell resistance to standard treatments (34). Chemotherapeutic agents routinely used in the initial therapy of osteosarcoma include methotrexate, doxorubicin, actinomycin D, etoposide, and alkylating agents (e.g., cisplatin, cyclophosphamide, ifosfamide, and thiotepa; ref. 32). Most of these agents work by damaging DNA that would be acted on by the DNA base excision repair pathway.

As a means to overcome osteosarcoma tumor cell resistance and/or to sensitize tumor cells to currently used chemotherapeutic treatments, we have begun analyses into the role DNA repair, particularly base excision repair, plays in osteosarcoma tumor cell resistance and prognosis. We determined that APE1 protein is elevated in 72% of the cases we studied and that there is a significant correlation between high APE1 expression levels and reduced survival times (Fig. 2).

Given this finding that APE1 is overexpressed in osteosarcoma, we attempted to modulate APE1 levels using the osteosarcoma cell line HOS to enhance chemo- and radiation sensitivity. We were able to accomplish this goal using the new technology of siRNA and targeting APE1. We were clearly able to knockdown APE1 protein levels greater than 90% of normal (Figs. 3 and 4). Furthermore, we showed that the decreased level of APE1 resulted in decreased APE1 endonuclease activity (Fig. 4) and increased sensitivity to MMS, H2O2, ionizing radiation, and alkylating and oxidizing DNA damaging agents (Fig. 5). Additionally, it seems the cells are dying via an apoptotic mechanism (Fig. 6).

There have been a small number of previous studies using DNA antisense methodology that implicates APE1 in cellular resistance to a variety of agents. For example, studies using antisense APE1 in human HeLa, rat glioma, or human lung carcinoma cells indicated that cells could be made hypersensitive to alkylating and oxidative agents, as well as ionizing radiation but not UV radiation (4, 35-37). However, it is not yet known whether the enhanced sensitivity of cells to these agents results from a loss of APE/ref-1's DNA repair function or its reduction-oxidation activity. Although much more information has been published implicating APE1 in tumor cell growth, proliferation, and drug resistance (4), little has been done for the past 8 years to determine which functional aspect of APE1 is responsible for enhancing cellular sensitivity to various agents. This is in part due to APE1 mouse knockouts being embryonic lethal on days E5 to E9 (38) and that no viable cell lines have been established that are completely deficient for APE1 (38). However, the siRNA data presented here are of significance as investigators will now be able to ascertain the role of decreased APE1 in cell lines.

The APE1-siRNA studies also implicate APE1 as a possible rate-limiting factor in chemotherapy and ionizing radiation damage repair and shows the feasibility for the therapeutic modulation of APE1 using a variety of molecules and approaches; for example, gene therapy using mutant APE1 (reduction-oxidation, repair or both), APE1-siRNA constructs, or pharmacologic inhibitors of APE1/ref-13 leading to sensitization of osteosarcoma cells to chemotherapy or ionizing radiation therapy.


    Acknowledgments
 
We thank Dr. Angie Evans for editorial assistance in the preparation of this manuscript.


    Footnotes
 
Grant support: NIH CA094025, CA106298, NS38506, ES05865, ES03456, and P30 DK49218; CDMRP OC00113 grant (M. Kelley); and Riley Children's Foundation postdoctoral fellowship (M. Luo).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

2 M. Lou, A. Reed, Y. He, and M. R. Kelley, unpublished data. Back

3 Data in preparation. Back

Received 2/19/04; revised 4/ 8/04; accepted 4/13/04.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Cell Culture
 Results
 Discussion
 References
 

  1. Ragland BD, Bell WC, Lopez RR, Siegal GP. Cytogenetics and molecular biology of osteosarcoma. Lab Invest 2002;82(4):365-73.[CrossRef][Medline]
  2. Rodriguez-Galindo C, Daw NC, Kaste SC, Meyer WH, Dome JS, Pappo AS, et al. Treatment of refractory osteosarcoma with fractionated cyclophosphamide and etoposide. J Pediatr Hematol Oncol 2002;24(4):250-5.[CrossRef][Medline]
  3. Limp-Foster M, Kelley MR. DNA repair and gene therapy: implications for translational uses. Environ Mol Mutagen 2000;35(2):71-81.[CrossRef][Medline]
  4. Evans AR, Limp-Foster M, Kelley MR. Going APE over ref-1. Mutat Res 2000;461(2):83-108.[Medline]
  5. Chen DS, Herman T, Demple B. Two distinct human DNA diesterases that hydrolyze 3'-blocking deoxyribose fragments from oxidized DNA. Nucleic Acids Res 1991;19(21):5907-14.[Abstract/Free Full Text]
  6. Demple B, Harrison L. Repair of oxidative damage to DNA: enzymology and biology. Ann Rev Biochem 1994;63:915-48.[CrossRef][Medline]
  7. Izumi T, Hazra TK, Boldogh I, Tomkinson AE, Park MS, Ikeda S, et al. Requirement for human AP endonuclease 1 for repair of 3'-blocking damage at DNA single-strand breaks induced by reactive oxygen species. Carcinogenesis 2000;21(7):1329-34.[Abstract/Free Full Text]
  8. Chou KM, Cheng YC. An exonucleolytic activity of human apurinic/apyrimidinic endonuclease on 3' mispaired DNA. Nature 2002;415(6872):655-9.[CrossRef][Medline]
  9. Chou KM, Kukhanova M, Cheng YC. A novel action of human apurinic/apyrimidinic endonuclease: excision of L-configuration deoxyribonucleoside analogs from the 3' termini of DNA. J Biol Chem 2000;275(40):31009-15.[Abstract/Free Full Text]
  10. Xanthoudakis S, Miao G, Wang F, Pan YC, Curran T. Redox activation of Fos-Jun DNA binding activity is mediated by a DNA repair enzyme. EMBO J 1992;11(9):3323-5.[Medline]
  11. Jayaraman L, Murthy KGK, Zhu C, Curran T, Xanthoudakis S, Prives C. Identification of redox/repair protein Ref-1 as a potent activator of p53. Genes Dev 1997;11:558-70.[Abstract/Free Full Text]
  12. Puglisi F, Barbone F, Tell G, Aprile G, Pertoldi B, Raiti C, et al. Prognostic role of Ape/Ref-1 subcellular expression in stage I-III breast carcinomas. Oncol Rep 2002;9(1):11-7.[Medline]
  13. Thomson B, Tritt R, Davis M, Kelley MR. Histology-specific expression of a DNA repair protein in pediatric rhabdomyosarcomas. Am J Pediatr Hematol Oncol 2001;23(4):234-9.[CrossRef][Medline]
  14. Schindl M, Oberhuber G, Pichlbauer EG, Obermair A, Birner P, Kelley MR. DNA repair-redox enzyme apurinic endonuclease in cervical cancer: evaluation of redox control of HIF-1{alpha} and prognostic significance. Int J Oncol 2001;19(4):799-802.[Medline]
  15. Robertson KA, Bullock HA, Xu Y, Tritt R, Zimmerman E, Ulbright TM, et al. Altered expression of Ape1/ref-1 in germ cell tumors and overexpression in NT2 cells confers resistance to bleomycin and radiation. Cancer Res 2001;61(5):2220-5.[Abstract/Free Full Text]
  16. Puglisi F, Aprile G, Minisini AM, Barbone F, Cataldi P, Tell G, et al. Prognostic significance of Ape1/ref-1 subcellular localization in non-small cell lung carcinomas. Anticancer Res 2001;21(6A):4041-9.[Medline]
  17. Moore DH, Michael H, Tritt R, Parsons SH, Kelley MR. Alterations in the expression of the DNA repair/redox enzyme APE/ref-1 in epithelial ovarian cancers. Clin Cancer Res 2000;6(2):602-9.[Abstract/Free Full Text]
  18. Xu Y, Moore DH, Broshears J, Liu LF, Wilson TM, Kelley MR. The apurinic/apyrimidinic endonuclease (APE/ref-1) DNA repair enzyme is elevated in premalignant and malignant cervical cancer. Anticancer Res 1997;17(5B):3713-9.[Medline]
  19. Robertson KA, Hill DP, Xu Y, Liu L, VanEpps S, Hockenbery DM, et al. Downregulation of AP endonuclease expression is associated with the induction of apoptosis in differentiating myeloid leukemia cells. Cell Growth & Differ 1997;8:443-9.[Abstract]
  20. Kelley MR, Cheng L, Foster R, Tritt R, Jiang J, Broshears J, et al. Elevated and altered expression of the multifunctional DNA base excision repair and redox enzyme Ape1/ref-1 in prostate cancer. Clin Cancer Res 2001;7(4):824-30.[Abstract/Free Full Text]
  21. Tell G, Zecca A, Pellizzari L, Spessotto P, Colombatti A, Kelly MR, et al. An ‘environment to nucleus’ signaling system operates in B lymphocytes: redox status modulates BSAP/Pax-5 activation through ref-1 nuclear translocation [In Process Citation]. Nucleic Acids Res 2000;28(5):1099-105.[Abstract/Free Full Text]
  22. Thomson BG, Tritt R, Davis M, Perlman EJ, Kelley MR. Apurinic/apyrimidinic endonuclease expression in pediatric yolk sac tumors. Anticancer Res 2000;20(6B):4153-7.[Medline]
  23. Freitas S, Moore DH, Michael H, Kelley MR. Studies of apurinic/apyrimidinic endonuclease/ref-1 expression in epithelial ovarian cancer: correlations with tumor progression and platinum resistance. Clin Cancer Res 2003;9(13):4689-94.[Abstract/Free Full Text]
  24. Vermes I, Haanen C, Steffens-Nakken H, Reutelingsperger C. A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin V. J Immunol Methods 1995;184(1):39-51.[CrossRef][Medline]
  25. Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002;296(5567):550-3.[Abstract/Free Full Text]
  26. Elbashir SM, Martinez J, Patkaniowska A, Lendeckel W, Tuschl T. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J 2001;20(23):6877-88.[CrossRef][Medline]
  27. Elbashir SM, Lendeckel W, Tuschl T. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev 2001;15(2):188-200.[Abstract/Free Full Text]
  28. Miyagishi M, Taira K. U6 promoter driven siRNAs with four uridine 3' overhangs efficiently suppress targeted gene expression in mammalian cells. Nat Biotechnol 2002;20(5):497-500.[CrossRef][Medline]
  29. Kreklau EL, Limp-Foster M, Liu N, Xu Y, Kelley MR, Erickson LC. A novel fluorometric oligonucleotide assay to measure O(6)-methylguanine DNA methyltransferase, methylpurine DNA glycosylase, 8-oxoguanine DNA glycosylase and abasic endonuclease activities: DNA repair status in human breast carcinoma cells overexpressing methylpurine DNA glycosylase. Nucleic Acids Res 2001;29(12):2558-66.[Abstract/Free Full Text]
  30. Lucidarme N, Valteau-Couanet D, Oberlin O, Couanet D, Kalifa C, Beaujen F, et al. Phase II study of high-dose thiotepa and hematopoietic stem cell transplantation in children with solid tumors. Bone Marrow Transplant 1998;22(6):535-40.[CrossRef][Medline]
  31. Kebudi R, Gorgun O, Ayan I. Oral etoposide for recurrent/progressive sarcomas of childhood. Pediatr Blood Cancer 2004;42(4):320-4.[CrossRef][Medline]
  32. Ferguson WS, Goorin AM. Current treatment of osteosarcoma. Cancer Invest 2001;19(3):292-315.[CrossRef][Medline]
  33. Ferrari S, Bertoni F, Mercuri M, Picci P, Giacomini S, Longhi A, et al. Predictive factors of disease-free survival for non-metastatic osteosarcoma of the extremity: an analysis of 300 patients treated at the Rizzoli Institute. Ann Oncol 2001;12(8):1145-50.[Abstract/Free Full Text]
  34. Trieb K, Kotz R. Proteins expressed in osteosarcoma and serum levels as prognostic factors. Int J Biochem Cell Biol 2001;33(1):11-7.[CrossRef][Medline]
  35. Walker LJ, Craig RB, Harris AL, Hickson ID. A role for the human DNA repair enzyme HAP1 in cellular protection against DNA damaging agents and hypoxic stress. Nucleic Acids Res 1994;22(23):4884-9.[Abstract/Free Full Text]
  36. Ono Y, Furuta T, Ohmoto T, Akiyama K, Seki S. Stable expression in rat glioma cells of sense and antisense nucleic acids to a human multifunctional DNA repair enzyme, APEX nuclease. Mutat Res 1994;315(1):55-63.[CrossRef][Medline]
  37. Chen DS, Olkowski ZL. Biological responses of human apurinic endonuclease to radiation-induced DNA damage. Ann NY Acad Sci 1994;726:306-8.[Medline]
  38. Wilson DM 3rd, Thompson LH. Life without DNA repair. Proc Natl Acad Sci USA 1997;94(24):12754-7.[Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
R. Chattopadhyay, S. Das, A. K. Maiti, I. Boldogh, J. Xie, T. K. Hazra, K. Kohno, S. Mitra, and K. K. Bhakat
Regulatory Role of Human AP-Endonuclease (APE1/Ref-1) in YB-1-Mediated Activation of the Multidrug Resistance Gene MDR1
Mol. Cell. Biol., December 1, 2008; 28(23): 7066 - 7080.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Jiang, C. Guo, M. R. Vasko, and M. R. Kelley
Implications of Apurinic/Apyrimidinic Endonuclease in Reactive Oxygen Signaling Response after Cisplatin Treatment of Dorsal Root Ganglion Neurons
Cancer Res., August 1, 2008; 68(15): 6425 - 6434.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
G.-M. Zou and A. Maitra
Small-molecule inhibitor of the AP endonuclease 1/REF-1 E3330 inhibits pancreatic cancer cell growth and migration
Mol. Cancer Ther., July 1, 2008; 7(7): 2012 - 2021.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Zaky, C. Busso, T. Izumi, R. Chattopadhyay, A. Bassiouny, S. Mitra, and K. K. Bhakat
Regulation of the human AP-endonuclease (APE1/Ref-1) expression by the tumor suppressor p53 in response to DNA damage
Nucleic Acids Res., March 1, 2008; 36(5): 1555 - 1566.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
L. A. Seiple, J. H. Cardellina II, R. Akee, and J. T. Stivers
Potent Inhibition of Human Apurinic/Apyrimidinic Endonuclease 1 by Arylstibonic Acids
Mol. Pharmacol., March 1, 2008; 73(3): 669 - 677.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. Yang, B. J. Misner, R. J. Chiu, and F. L. Meyskens Jr
Redox effector factor-1, combined with reactive oxygen species, plays an important role in the transformation of JB6 cells
Carcinogenesis, November 1, 2007; 28(11): 2382 - 2390.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Couve-Privat, G. Mace, F. Rosselli, and M. K. Saparbaev
Psoralen-induced DNA adducts are substrates for the base excision repair pathway in human cells
Nucleic Acids Res., September 27, 2007; 35(17): 5672 - 5682.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. J. Raffoul, S. Banerjee, V. Singh-Gupta, Z. E. Knoll, A. Fite, H. Zhang, J. Abrams, F. H. Sarkar, and G. G. Hillman
Down-regulation of Apurinic/Apyrimidinic Endonuclease 1/Redox Factor-1 Expression by Soy Isoflavones Enhances Prostate Cancer Radiotherapy In vitro and In vivo
Cancer Res., March 1, 2007; 67(5): 2141 - 2149.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G.-M. Zou, M.-H. Luo, A. Reed, M. R. Kelley, and M. C. Yoder
Ape1 regulates hematopoietic differentiation of embryonic stem cells through its redox functional domain
Blood, March 1, 2007; 109(5): 1917 - 1922.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
D. R. McNeill and D. M. Wilson III
A Dominant-Negative Form of the Major Human Abasic Endonuclease Enhances Cellular Sensitivity to Laboratory and Clinical DNA-Damaging Agents
Mol. Cancer Res., January 1, 2007; 5(1): 61 - 70.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
W. Lam, S.-Y. Park, C.-H. Leung, and Y.-C. Cheng
Apurinic/Apyrimidinic Endonuclease-1 Protein Level Is Associated with the Cytotoxicity of L-Configuration Deoxycytidine Analogs (Troxacitabine and beta-L-2',3'-Dideoxy-2',3'-didehydro-5-fluorocytidine) but Not D-Configuration Deoxycytidine Analogs (Gemcitabine and beta-D-Arabinofuranosylcytosine)
Mol. Pharmacol., May 1, 2006; 69(5): 1607 - 1614.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. S. Bobola, L. S. Finn, R. G. Ellenbogen, J. R. Geyer, M. S. Berger, J. M. Braga, E. H. Meade, M. E. Gross, and J. R. Silber
Apurinic/Apyrimidinic Endonuclease Activity Is Associated with Response to Radiation and Chemotherapy in Medulloblastoma and Primitive Neuroectodermal Tumors
Clin. Cancer Res., October 15, 2005; 11(20): 7405 - 7414.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Madhusudan, F. Smart, P. Shrimpton, J. L. Parsons, L. Gardiner, S. Houlbrook, D. C. Talbot, T. Hammonds, P. A. Freemont, M. J. E. Sternberg, et al.
Isolation of a small molecule inhibitor of DNA base excision repair
Nucleic Acids Res., August 19, 2005; 33(15): 4711 - 4724.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Pines, L. Perrone, N. Bivi, M. Romanello, G. Damante, M. Gulisano, M. R. Kelley, F. Quadrifoglio, and G. Tell
Activation of APE1/Ref-1 is dependent on reactive oxygen species generated after purinergic receptor stimulation by ATP
Nucleic Acids Res., August 2, 2005; 33(14): 4379 - 4394.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Cai, Y. Xu, R. J. Cooper, M. J. Ferkowicz, J. R. Hartwell, K. E. Pollok, and M. R. Kelley
Mitochondrial Targeting of Human O6-Methylguanine DNA Methyltransferase Protects against Cell Killing by Chemotherapeutic Alkylating Agents
Cancer Res., April 15, 2005; 65(8): 3319 - 3327.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Sossou, C. Flohr-Beckhaus, I. Schulz, F. Daboussi, B. Epe, and J. P. Radicella
APE1 overexpression in XRCC1-deficient cells complements the defective repair of oxidative single strand breaks but increases genomic instability
Nucleic Acids Res., January 12, 2005; 33(1): 298 - 306.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, D.
Right arrow Articles by Kelley, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, D.
Right arrow Articles by Kelley, M. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics