Molecular Cancer Therapeutics Genome- No Abstract
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Salvi, A.
Right arrow Articles by Barlati, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Salvi, A.
Right arrow Articles by Barlati, S.
Mol Cancer Ther. 2004;3:671-678
© 2004 American Association for Cancer Research

Small interfering RNA urokinase silencing inhibits invasion and migration of human hepatocellular carcinoma cells

Alessandro Salvi, Bruna Arici, Giuseppina De Petro and Sergio Barlati

Division of Biology and Genetics, Department of Biomedical Sciences and Biotechnology, IDET Centre of Excellence, University of Brescia, Brescia, Italy

Requests for reprints: Sergio Barlati, Division of Biology and Genetics, Department of Biomedical Sciences and Biotechnology, University of Brescia, Viale Europa n.11, 25123 Brescia, Italy. Phone: 0039-030-3717-241; Fax: 0039-030-3701-157. E-mail: barlati{at}med.unibs.it


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 DNA Extraction
 Results
 Discussion
 References
 
The serine protease urokinase-type plasminogen activator (u-PA) is involved in a variety of physiologic and pathological processes; in particular, u-PA mRNA is up-regulated in human hepatocellular carcinoma (HCC) biopsies and its level of expression is inversely correlated with patients' survival. To determine the role of u-PA in the invasiveness properties of HCC, we successfully down-regulated u-PA by RNA interference (RNAi) technology, in an HCC-derived cell line at high level of u-PA expression. RNAi is a multistep process involving generation of small interfering RNAs (siRNA) that cause specific inhibition of the target gene. SKHep1C3 cells were transfected with a U6 promoter plasmid coding for an RNA composed of two identical 19-nucleotide sequence motifs in an inverted orientation, separated by a 9-bp spacer to form a hairpin dsRNA capable of mediating target u-PA inhibition. Stable transfectant cells showed a consistently decreased level of u-PA protein. In biological assays, siRNA u-PA–transfected cells showed a reduction of migration, invasion, and proliferation. In conclusion, u-PA down-regulation by RNAi technology decreases the invasive capability of HCC cells, demonstrating that stable expression of siRNA u-PA could potentially be an experimental approach for HCC gene therapy.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 DNA Extraction
 Results
 Discussion
 References
 
The urokinase-type plasminogen activator (u-PA) is a multifunctional serine protease that plays important roles in various physiologic and pathologic conditions. In recent decades, it has become clear that the plasminogen activation system, which mainly consists of u-PA, u-PA receptor (u-PAR), and plasminogen activator inhibitor 1 (PAI-1), plays a very important role in the aggressiveness of cancer (1-3). Such enzymatic system governs the proteolytical degradation of extracellular matrix and basement membrane, allowing cells to move across and through these barriers in the processes of tumor invasion and metastasis (4-7).

The most relevant proteolytical activity of u-PA regards plasminogen, which is converted to the active enzyme, plasmin, which is capable of degrading a broad spectrum of extracellular proteins both by directly degrading extracellular matrix components and by activating collagenases and metalloproteases (8, 9). Also, it is well known that a signal is initiated by the binding of u-PA to u-PAR and transduced to the intracellular compartment by a mechanism not involving plasmin generation. In fact, u-PA/u-PAR system is involved in activating cell signaling pathways, including diacylglycerol formation, activation of a serine kinase, focal adhesion kinase, tyrosine kinase(s), and the activation of transcription pathways (4, 10). u-PA also exerts proliferative actions (11-14) independently of its proteolytic activity. Both the inactivated form of u-PA and the amino-terminal fragment of u-PA molecule (which has no proteolytic activity) are capable of inducing a mitogenic response (15). Furthermore, the u-PA/u-PAR complex has also been shown to be involved in regulating cell migration and adhesion through its interaction with integrins and with vitronectin, an extracellular matrix component (4, 16-18).

Hepatocellular carcinoma (HCC) is an aggressive tumor with a poor prognosis. Many studies of the molecular biology of this tumor have revealed that quantitative and qualitative changes in gene expression occur during its evolution. We have previously shown that u-PA is up-regulated in human tumoral liver tissue and its level of expression is inversely correlated with patients' survival; furthermore, high levels of u-PA mRNA can be considered an unfavorable prognostic marker for HCC patients (19).

In a previous work, we down-regulated u-PA in SKHep1C3 cells, an HCC-derived cell line, by stable expression of antisense RNA technology (20). To avoid possible aspecific responses by the cells resulting in cytotoxicity and apoptosis following transfection or intracellular production of RNA duplex longer than about 30 nucleotides (nt; refs. 21-23), we successfully used a recent technological breakthrough that allows delivery of short dsRNA, small interfering RNA (siRNA), by a plasmid into eukaryotic cells to down-modulate u-PA expression (24-30).

In this study, we transfected SKHep1C3 cells with a plasmid in which we cloned DNA fragments that acted as templates for the synthesis of siRNAs under the control of the U6 promoter. The resulting RNA was composed of two identical 19-nt sequence motifs in an inverted orientation, separated by a 9-bp spacer to form a hairpin dsRNA capable of mediating target u-PA inhibition via posttranscriptional gene silencing. The results obtained confirm and demonstrate that the proliferative, invasive, and migrative capabilities of HCC cells can be reduced by u-PA target siRNA. Blocking of u-PA expression by siRNA could be a direct approach for reducing both the proteolytical and the signal transduction activity of the enzyme.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
DNA Extraction
 Results
 Discussion
 References
 
Cell Lines
SKHep1Clone3 (SKHep1C3; ref. 31), selected from human HCC-derived cells (SKHep1: ATCC HTB52) and SKHep1C3–transfected cells, were maintained in Earle's MEM supplemented with 10% fetal calf serum (Life Technologies, Inc., Gaithersburg, MD) at 37°C in a 5% CO2 incubator. AB5 human dermal fibroblasts (12) were also cultured in the same conditions.

Design and Preparation of Constructs
For design siRNA targeting u-PA, a DNA sequence of the type AA(N19) was selected. This sequence (AACATTCACTGGTGCAACTGC) corresponded to nucleotides 208 to 228 of the human u-PA mRNA (National Center for Biotechnology Information access number: A35395). Synthetic sense and antisense oligonucleotides (Sigma-Genosys, The Woodlands, TX) constitute the template for generating RNA composed of two identical 19-nt sequence motifs in an inverted orientation, separated by a 9-bp spacer to form a double strand hairpin of siRNA. Two micrograms of each oligonucleotide were annealed for 3 minutes at 90°C and for 1 hour at 37°C and then ligated into 2 µg of pSILENCER 1.0-U6 plasmid (containing ampicillin resistance gene and the mouse U6 RNA Polymerase III promoter; Ambion, Woodward, Austin, TX) linearized with ApaI and EcoRI (Fig. 1). The construct was cloned in TOP10 chemically competent Escherichia coli, according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). The sequence of the insert was confirmed by automated sequencing and by analyzing the fragments generated from digestion with HindIII.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. A, schematic presentation of U6 RNA Polymerase III promoter-based siRNA expression vector. Sequence encoding siRNA with 19 nt of homology to u-PA is inserted immediately downstream of U6 promoter. The six thymidines serve as a termination signal for Polymerase III. B, predicted second structure of the siRNA u-PA transcript from the expression vector.

 
Transfection and Selection
SKHep1C3 cells were grown to a confluency of 60% to 80% (in 6-cm–diameter Petri dishes) and then cotransfected (24) with 10 µg of pSILENCER 1.0-U6 and 1 µg of pEF6/V5-His TOPO vector (Invitrogen; the plasmid containing the blasticidine-selectable marker gene) using DOTAP Liposomal transfection reagent according to the manufacturer's instructions (Invitrogen).

Transfected cells were selected for blasticidine resistance (6 µg/mL; pS: cells transfected with vector-alone; pS siRNA u-PA: cells transfected with siRNA u-PA construct).


   DNA Extraction
Top
 Abstract
 Introduction
 Materials and Methods
 DNA Extraction
Results
 Discussion
 References
 
Genomic DNA from parental and transfected cells was obtained with Purgene reagent (Gentra system, Minneapolis, MN). To verify transfection, we amplified 50 ng of DNA from SKHep1C3, pS, and pS siRNA u-PA cells with a pair of pSILENCER 1.0-U6 specific primers, pSFOR (5'-GAGACTATAAATATCCCTTGGAG-3') and pSREV (5'-CCGCTCTAGAACTAGTGGAT-3'), flanking the region of insert. The size of PCR products was 118 bp for mocked plasmid and 133 bp for plasmid with siRNA insert.

Reverse Transcription-PCR Analysis
Total RNA of transfected SKHep1C3 was extracted, quantified, and reverse transcribed as described (32). The following reverse transcription (RT)-PCR was done to determine the percentage of u-PA mRNA inhibition: 2 µg of total RNA were reverse transcribed using u-PART (5'-ATGCTGCAGAATAAGTACATTC-3') specific reverse primer in the 3' UTR of u-PA mRNA, and the amplification reaction was done essentially as described previously (33). In parallel, the same amount from the same preparation of total RNA was retrotranscribed using random examers to verify the integrity of RNA and adequate cDNA synthesis using glyceraldehyde-3-phosphate dehydrogenase 1/2 (GAPDH1/2) specific primers. Quantification of the ribosomal protein L7, phosphoglycerate kinase 1 (PGK1), and ß-actin expression was also done using specific primers (20).

Endogenous u-PA was detected by PCR analysis (conducted on cDNA specific for u-PA) with u-PAE/u-PAF; u-PAE: 5'-TCCTGACTCAACATGTTACTGAC-3' (nt 1583 to 1605); u-PAF: 5'-ATACATTCATGGAATATCAGAGC-3' (nt 1846 to 1868). A comparative PCR method was used to determine the percentage of inhibition of u-PA, together with an image analysis system (IAS) able to scan the PCR amplified products directly from the images of the agarose gel bands, thus, obtaining a relative quantification of the u-PA products in comparison with the expression level of u-PA in SkHep1C3 untransfected cells. The relative values were expressed in pixels as integrated density (19).

Immunofluorescence
For the immunofluorescence detection of u-PA, u-PAR, and GAPDH, SKHep1C3 and SKHep1C3–transfected cells were seeded (40,000 cells/22 x 22 mm glass coverslips in 3-cm–diameter Petri dishes) and treated according to the standard protocol described previously (34). The cultures were fixed in cold methanol and then immunoreacted with the first antibodies, polyclonal antibodies anti-human u-PA (TechnoClone, Vienna, Austria), anti-GAPDH (Chemicon International, Temecula, CA), and anti-u-PAR (mouse monoclonal anti-u-PAR antibodies were kindly provided by Prof. F. Blasi, DIBIT, Istituto Scientifico San Raffaele, Milan, Italy). The cells were then immunoreacted with the secondary antibodies fluorescein-conjugated anti-rabbit IgG and rhodamine-conjugated anti-mouse IgG (Calbiochem, San Diego, CA; ref. 33). The coverslips were mounted on glass slides in mounting medium and photographed with a Leitz fluorescence microscope (x100 magnification). Ten randomly chosen fields were analyzed for each cell type with a specific analysis system (IAS) program to evaluate the integrated optical density level of each immunofluorescent cell. Analysis of variance was done considering SKHep1C3, pS and pS siRNA u-PA, u-PAR, and GAPDH integrated optical density levels. The data were considered to be significant when P ≤ 0.05.

Western Blot Analysis and Zymography
The conditioned media were prepared and analyzed by Western blotting, as described previously (34). The 24-hour serum-free conditioned media (2 mL/6-cm–diameter Petri dish) were collected from confluent cultures of parental, pS, and pS siRNA u-PA–transfected cells. Constant amounts of proteins (19.8 µg) from conditioned media of transfected and non-transfected cells were loaded in SDS-PAGE, under non-reducing conditions, on a polyacrylamide gel composed of three layers, containing different acrylamide concentrations at 4%, 6%, and 12%. Gel was blotted on nitrocellulose membranes and immunoreacted with rabbit anti-human u-PA antibodies (1:1,000 in 1% bovine serum albumin) or overlaid onto casein agar containing 2 µg/mL of human plasminogen (TechnoClone) to evaluate u-PA activity (20). Proteins (19.8 µg) from conditioned media of transfected and non-transfected cells were also loaded on an 8% polyacrylamide gel, electroblotted onto a nitrocellulose membrane, and immunoblotted using goat polyclonal antibodies anti-PAI-1 (1:500 in 0.3% bovine serum albumin) and alkaline phosphatase-conjugated anti-goat IgG (1:7,500 v/v) to verify constant amount of loaded proteins.

The cell extracts were prepared as described (34, 35). Constant amounts of proteins (12.6 µg/well) were loaded on an 8% polyacrylamide gel. The separated proteins were electroblotted onto a nitrocellulose membrane, then immunoblotted using mouse monoclonal antibodies anti-GAPDH (1:300 in 1% bovine serum albumin) and alkaline phosphatase-conjugated anti-mouse IgG, rabbit polyclonal antibodies anti-protein kinase R (anti-PKR), anti-phospo-PKR (Thr 446/451), anti-eIF{alpha} (eIF2{alpha}: {alpha} subunit of eukaryotic initiation factor 2), anti-phospho-eIF{alpha} (Ser51; 1:1,000 in 5% bovine serum albumin; Cell Signaling Technology, Beverly, MA), and alkaline phosphatase-conjugated anti-rabbit IgG.

The positive immunoreaction was detected with nitroblue tetrazolium and bromochloroindolyl phosphate (Promega, San Diego, CA). The bands were scanned by a digital system (IAS) and the values of integrated density were expressed in pixels (34). The amount of u-PA protein in SKHep1C3 untransfected cells was considered as 100%.

Invasion and Motility
Invasion and motility assays were done in a 24-well transwell chamber (Costar, Bodenheim, Germany). The 8-µm pore inserts were coated with 15 µg of Matrigel (Becton Dickinson Labware, Bedford, MA). Cells were added to coated filters (2 x 105 cells/filter) in 100 µL of serum-free medium in triplicate wells. In the lower compartments of the chambers, a volume of 600 µL of AB5 human fibroblast-serum-free-conditioned media was used as chemoattractant. After 24 hours at 37°C in a 5% CO2 incubator, the Matrigel coating on the upper surface of the filter was wiped off using a cotton swab. Cells that migrated through the filters were fixed, stained with Hema-3, photographed, and counted.

The motility assay was conducted in a similar fashion but without coating with Matrigel. Cells (1 x 105/filter) were loaded on transwell polycarbonate membrane inserts in triplicate wells. The plates were incubated for 24 hours at 37°C in a 5% CO2 incubator, then the cells in the lower wells were fixed, stained with Hema-3, and counted. The cells that had migrated to the lower compartment of the chambers were trypsinized and counted. Each experiment was carried out in triplicate. The statistical significance of the results was calculated using the ANOVA procedure. The data were considered to be significant when P ≤ 0.05.

Proliferation Assay
SKHep1C3 and SKHep1C3-transfected cells were seeded (1.25 x 104 cells/dish) in triplicate in 3-cm–diameter Petri dishes. After 24, 48, and 72 hours of incubation at 37°C, the cells were trypsinized and counted using a Burker chamber.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 DNA Extraction
 Results
Discussion
 References
 
Selection of siRNA Transfectants
SKHep1C3 cells were cotransfected with pSILENCER 1.0-U6 generating short hairpin siRNA and with pEF6/V5-His TOPO expression vector carrying selectable blasticidine marker as described in the Materials and Methods section. Transfected cells were selected for blasticidine resistance and characterized by the presence of the insert in the genomic DNA (data not shown).

RT-PCR Analysis of u-PA Expression
Molecular characterization of parental (SKHep1C3) and transfected cells (pS and pS siRNA u-PA) was carried out by semiquantitative RT-PCR analysis of u-PA mRNA expression. Following standardization for the level of GAPDH, detected at comparable levels in all cell lines (Fig. 2B), u-PA mRNA was found to be markedly reduced in pS siRNA u-PA cells, whereas pS cells showed substantially the same levels of parental cell u-PA mRNA (Fig. 2A). Other mRNAs, such as ß-actin, ribosomal protein L7, and phosphoglycerate kinase 1 (PGK1), were found to be comparable in all three cell lines (Fig. 2C-E).



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. RT-PCR detection of u-PA, GAPDH, ß-actin, L7, and PGK1 (A to E, respectively) in SKHep1C3 and transfected cells (pS and pS siRNA u-PA). The amounts of u-PA, GAPDH, ß-actin, L7, and PGK1 RT-PCR products (286, 457, 582, 280, 350 bp, respectively) were evaluated using a digital image analysis system (IAS) and the relative percentages of u-PA mRNA values were calculated as reported in Materials and Methods. Columns, mean values of two different experiments; error bars, SD.

 
Immunoblotting Analysis and Zymography
To determine whether the expression of siRNA u-PA affected u-PA protein production and secretion, constant protein amounts of conditioned media from parental, vector, and siRNA u-PA–transfected cells were used to perform Western blotting analysis with polyclonal anti-u-PA antibodies. A specific protein band (Mr = 55,000) was present in all the samples and was reduced by 95% in the pS siRNA u-PA conditioned media (Fig. 3A). Figure 3B shows that u-PA enzymatic activity was also found to be decreased in pS siRNA u-PA cells. To determine whether any changes in total amount of protein production and secretion had occurred, we tested constant amounts of proteins from conditioned media and from cellular extract of transfected and control cells by Western blotting analysis with polyclonal anti-PAI-1 (for conditioned media) and monoclonal anti-GAPDH (for cellular extract) antibodies. No differences in PAI-1 (Mr = 43,000) and GAPDH expression (Mr = 36,000) between parental and transfected cells were found (Fig. 3C and D, respectively).



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Western blotting determination of u-PA (A), PAI-1 (C), and GAPDH (D) protein amount in SKHep1C3 and transfected cells using polyclonal anti-human u-PA, polyclonal anti-goat PAI-1, and monoclonal anti-GAPDH antibodies as described in Materials and Methods. B, zymographic analysis of u-PA activity in conditioned serum-free medium of SKHep1C3 and transfected cells.

 
To evaluate the possible activation of PKR and of {alpha} subunit of eukaryotic initiation factor 2 (eIF2{alpha}), the levels of phosphorylated and unphosphorylated forms of PKR and of eIF2{alpha} were examined in transfected and in non-transfected cells. Western blot analysis of PKR (Mr = 74,000) and eIF2{alpha} (Mr = 40,000) showed similar levels in non-transfected and transfected cells; the lack of phosphorylation of PKR together with the lack of phosphorylation of eIF2{alpha} excludes the activation of PKR cell signaling pathway in siRNA u-PA–transfected cells (Fig. 4).



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. Detection of PKR, phospho-PKR, eIF{alpha}, and phospho-eIF{alpha} in cellular extract of SKHep1C3, pS, and pS siRNA u-PA cells, verified by immunoblotting.

 
Immunofluorescence Analysis of GAPDH, u-PA, and u-PAR Protein Expression
Immunofluorescence analysis with polyclonal anti-u-PA, monoclonal anti-u-PAR, and monoclonal anti-GAPDH antibodies showed that u-PA and u-PAR fluorescent protein signal of pS siRNA u-PA cells was reduced by 89% and 74%, respectively, compared with parental and vector-alone cell lines (P < 0.01) (Fig. 5). GAPDH immunofluorescent signal was similar in non-transfected and transfected cells (Fig. 5).



View larger version (59K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. Immunofluorescence analysis of GAPDH, u-PA, and u-PAR protein expression in SKHep1C3 and transfected cells. Original magnification x63.

 
Effect of siRNA u-PA on Cell Invasion, Motility, and Proliferation
The in vitro invasion assay was designed to test whether transfection of siRNA u-PA altered the invasive potential of tumor cells in Matrigel-coated transwell chamber. Considering as 100% the number of SKHep1C3 cells able to invade to the filters in 24 hours, the percentage of vector-alone–transfected cells was 83% and that of siRNA u-PA–transfected cells 27% (Fig. 6A). The invasive potential of pS siRNA u-PA cells appeared significantly reduced (P < 0.05).



View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 6. Invasion (A) and motility (B) of parental, vector, and siRNA u-PA–transfected cells. The percentage of invading (t = 24 hours) and migrating (t = 24 hours) cells was calculated as reported in Materials and Methods. The pictures highlight the differences in number between the SKHep1C3, pS, and pS siRNA u-PA cells able to invade (A) or migrate (B) to the lower surface of transwells. The cells were stained with Hema-3. C, in vitro growth of SKHep1C3 and transfected cells (pS and pS siRNA u-PA). Columns, averages of three independent experiments; error bars, SD.

 
To study the effect of siRNA u-PA transfection on migration, parental and transfected cells were seeded on transwell chambers with uncoated filters. After 24 hours of incubation, the motility potential of pS siRNA u-PA cells was strongly inhibited (Fig. 6B; P < 0.05).

To determine changes in the growth pattern of SKHep1C3 cells stably transfected with siRNA u-PA, a growth curve was done on them along with parental cells and the cells transfected with the empty vector. u-PA inhibition by siRNA u-PA transfection modulated the proliferation of hepatocellular carcinoma cells; in fact, the proliferation of pS siRNA u-PA cells was markedly decreased compared with parental and vector-alone–transfected cells (P < 0.05) (Fig. 6C), thus, indicating u-PA involvement in the proliferative potential of hepatocarcinoma cells.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 DNA Extraction
 Results
 Discussion
References
 
The u-PA converts the proenzyme plasminogen to enzymatic active plasmin. It is controlled by PAIs, of which PAI-1 seems to be the main physiologic inhibitor. u-PA has its receptor in a membrane-anchored glycoprotein (u-PAR/CD87), which has been implicated in pericellular proteolysis during cell migration or tissue reorganization (4, 6). The u-PA/u-PAR may be a multifunctional system, not only promoting extracellular matrix proteolysis, but also involved in integrin-mediated cell adhesion and migration by interaction with vitronectin (16). Furthermore, u-PA/u-PAR system has been implicated in intracellular signaling, cellular differentiation, growth, and chemotaxis via a mechanism independent of u-PA enzymatic activity (19).

There is considerable evidence of an association between u-PA expression and the mitogenic activity of the cells (36, 37). In vitro studies have shown that u-PA acts as an autocrine mitogen in human melanoma cells (11). In addition, exogenous u-PA induces the proliferation and growth of cells of various origins (12, 13).

We have previously shown that u-PA gene transcription is up-regulated in human HCC tissues and that high levels of u-PA mRNA can be considered an unfavorable prognostic marker for HCC patients (19, 38). RNA duplexes of 19 to 23 nt (called siRNAs) have recently been shown to mediate the inhibition of gene expression: this mechanism is called RNA interference (RNAi; refs. 24, 29, 30). RNAi has rapidly become a functional genomics tool in a broad range of species; it has been used for transient or stable knock down of gene expression in cell lines and very recently in experimental animal models. Several genes have been successfully knocked down by RNAi in mammalian cells due to improved siRNA delivery systems, and attention is now turning to verification of the potential of RNAi as a tool for gene therapy (39, 40). RNAi has the greatest impact as an experimental therapeutic approach in two clinical areas: cancer and infective diseases.

In this work, we down-modulated u-PA via siRNA stable expression strategy in SKHep1C3 hepatocarcinoma-derived cell line, characterized by high levels of u-PA mRNA expression. This approach may provide important evidence of the role of u-PA in specific malignant properties of HCC-derived cells. The production and the secretion of u-PA were greatly reduced in siRNA u-PA–transfected cells compared with control cells. Significant inhibition of u-PA protein production was found despite reduced inhibition of mRNA u-PA expression.

In our system, the lack of phosphorylation of PKR and the lack of phosphorylation of eIF2{alpha} in siRNA u-PA–transfected cells, verified by immunoblotting analysis, excludes activation of the IFN pathway. Reduction of u-PA protein was not due to a non-specific inhibition of translation via the PKR pathway. At the mRNA level, RT-PCR expression of four housekeeping genes has been found to be constant in transfected and in non-transfected cells. All these data indicate that the decrease of target u-PA seems to be specific. The mechanism of action of siRNA in mammalian cells has as yet been poorly investigated. Some authors suggest that siRNAs might work as microRNAs (41), which knock down gene expression not only via mRNA degradation but also/or via translation arrest. This is probably due to imperfect pairing between antisense strand of microRNA/siRNA and mRNA that does not allow mRNA cleavage; the result is a block in the translation process (41). Additional mechanisms such as changes in DNA methylation or chromatin structure may also be involved (42). For all these reasons, RNAi studies are now proceeding in two directions: to understand the mechanism of action of siRNA in mammalian cells and to test more therapeutic applications.

In our system, the amount of u-PAR protein, detected by immunofluorescence analysis, was also shown to be lower in siRNA u-PA–transfected cells. Our results are in line with what is known about the ability of u-PA to up-regulate the expression of its cellular receptor at a transcriptional level, by increasing the activity of the transcriptional factor Sp1, and also at a posttranscriptional level, by promoting u-PAR mRNA stability (43, 44). There is considerable evidence that the u-PA/u-PAR system plays a role in tumor cell proliferation (45, 46). In our study, we observed that siRNA u-PA–transfected cells were characterized by reduced proliferation.

In summary, we have shown that inhibition of endogenous u-PA using siRNA technology reduced the motility, invasion, and proliferation of HCC cells. Many authors have shown that the u-PA system is a therapeutic target for a variety of human tumors, not only for HCC (1, 47), and our results obtained using RNAi technology provide further support. Some authors have used RNAi in liver disease, but as yet only one group has directly transfected siRNA oligos in HCC-derived cells targeting cyclin E, which controls the progression from G1 to S phase and when overexpressed is involved in carcinogenesis of HCC (48). Other authors have investigated the effect of RNAi activity on the replication of HCV (49) and HBV (50) viruses, which are responsible for hepatitis C and B, respectively. The results showed a sharp reduction in the levels of replicative intermediates and viral protein. To our knowledge, this is the first report of inhibition of u-PA in HCC tumorigenic cells using RNAi technology. Although we obtained comparable u-PA inhibition with plasmid expressing antisense u-PA mRNA, the advantages provided by siRNA technology should be relevant for in vivo studies avoiding aspecific defense responses against duplex RNA longer than 30 nt (21-23).

In conclusion, our findings confirm that down-modulation of u-PA may be an effective way of achieing a significant reduction in the malignant properties of HCC-derived cells and the results obtained from siRNA u-PA technologies may be of help in designing and testing in vivo anti-invasive therapeutic strategies.


   Acknowledgments
 
Our thanks go to Shelley Wintle (University of Brescia, Italy) for revising the English.


   Footnotes
 
Grant support: Ministero dell'Istruzione, dell'Università e della Ricerca (MIUR), Centro Eccellenza IDET, Fondazione Cariplo and Consiglio Nazionale delle Ricerche and MIUR in the context of Progetto Strategico Oncologia.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 12/30/03; revised 2/27/04; accepted 4/ 2/04.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 DNA Extraction
 Results
 Discussion
 References
 

  1. Schmitt M, Wilhelm OG, Reuning U, et al. The urokinase plasminogen activator system as a novel target for tumor therapy. Fibrinolysis Proteolysis 2000;14:114-32.[CrossRef]
  2. Zhou L, Hayashi Y, Itoh T, Wang W, Rui J, Itoh H. Expression of urokinase-type plasminogen activator, urokinase type plasminogen activator receptor, and plasminogen activator inhibitor-1 and -2 in hepatocellular carcinoma. Pathol Int 2000;50:392-7.[CrossRef][Medline]
  3. Muehlenweg B, Sperl S, Magdolen V, Schmitt M, Harbeck N. Interference with the urokinase plasminogen activator system: a promising therapy concept for solid tumours. Exp Opin Biol Ther 2001;1:683-91.
  4. Blasi F, Carmeliet P. u-PAR: a versatile signalling orchestrator. Nat Rev Mol Cell Biol 2002;3:932-43.[CrossRef][Medline]
  5. Khatib AM, Nip J, Fallavollita L, Lehmann M, Jensen G, Brodt P. Regulation of urokinase plasminogen activator/plasmin-mediated invasion of melanoma cells by the integrin vitronectin receptor {alpha}Vß3. Int J Cancer 2001;91:300-8.[CrossRef][Medline]
  6. Andreasen PA, Kjoller L, Christensen L, Duffy MJ. The urokinase-type plasminogen activator system in cancer metastasis: a review. Int J Cancer 1997;72:1-22.[CrossRef][Medline]
  7. Ossowski L. Plasminogen activator dependent pathways in the dissemination of human tumor cells in the chick embryo. Cell 1988;52:321-8.[CrossRef][Medline]
  8. Barlati S. Plasminogen activators and fibronectin fragments in tumor growth and signal transduction. Bull Inst Pasteur 1994;92:269-75.
  9. Murakami K, Sakukawa R, Ikeda T, et al. Invasiveness of hepatocellular carcinoma cell lines: contribution of membrane-type 1 matrix metalloproteinase. Neoplasia 1999;1:424-30.[CrossRef][Medline]
  10. Blasi F. The urokinase receptor and cell migration. Semin Thromb Hemost 1996;22:513-6.[Medline]
  11. Kirchheimer JC, Wojta J, Christ G, Binder BR. Functional inhibition of endogenously produced urokinase decreases cell proliferation in a human melanoma cell line. Proc Natl Acad Sci USA 1989;86:5424-8.[Abstract/Free Full Text]
  12. De Petro G, Copeta A, Barlati S. Urokinase-type and tissue-type plasminogen activators as growth factors of human fibroblasts. Exp Cell Res 1994;213:286-94.[CrossRef][Medline]
  13. Fischer K, Lutz V, Wilhelm O, et al. Urokinase induces proliferation of human cancer cells: characterization of structural elements required for growth factor function. FEBS Lett 1998;438:101-5.[CrossRef][Medline]
  14. Stepanova V, Mukhina S, Köhler E, Resink TJ, Erne P, Tkachuk VA. Urokinase plasminogen activator induces human smooth muscle cell migration and proliferation via distinct receptor-dependent and proteolysis-dependent mechanisms. Mol Cell Biochem 1999;195:199-206.[CrossRef][Medline]
  15. Rabbani SA, Mazar AP, Bernier SM, et al. Structural requirements for the growth factor activity of the amino-terminal domain of urokinase. J Biol Chem 1992;267:14151-6.[Abstract/Free Full Text]
  16. Chapman HA. Plasminogen activators, integrins, and the coordinated regulation of cell adhesion and migration. Curr Opin Cell Biol 1997;9:714-24.[CrossRef][Medline]
  17. Stahl A, Mueller BM. Melanoma cell migration on vitronectin: regulation by components of the plasminogen activation system. Int J Cancer 1997;71:116-22.[CrossRef][Medline]
  18. Kanse SM, Kost C, Wilhelm OG, Andreasen PA, Preissner KT. The urokinase receptor is a major vitronectin-binding protein on endothelial cells. Exp Cell Res 1996;224:344-53.[CrossRef][Medline]
  19. De Petro G, Tavian D, Copeta A, Portolani N, Giulini SM, Barlati S. Expression of urokinase-type plasminogen activator (u-PA), u-PA receptor, and tissue-type PA messenger RNAs in human hepatocellular carcinoma. Cancer Res 1998;58:2234-9.[Abstract/Free Full Text]
  20. Tavian D, Salvi A, De Petro G, Barlati S. Stable expression of antisense urokinase mRNA inhibits the proliferation and invasion of human hepatocellular carcinoma cells. Cancer Gene Ther 2003;10:112-20.[Medline]
  21. Caplen JC, Parrish S, Imani F, Fire A, Morgan RA. Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems. Proc Natl Acad Sci USA 2001;98:9742-7.[Abstract/Free Full Text]
  22. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschi T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2001;411:494-8.[CrossRef][Medline]
  23. Bass BL. The short answer. Nature 2001;411:428-9.[CrossRef][Medline]
  24. Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002;296:550-3.[Abstract/Free Full Text]
  25. Agami R. RNAi and related mechanisms and their potential use for therapy. Curr Opin Chem Biol 2002;6:829-34.[CrossRef][Medline]
  26. Sui G, Soohoo C, Affar EB, et al. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci USA 2002;99:5515-20.[Abstract/Free Full Text]
  27. Miyagishi M, Taira K. U6 promoter-driven siRNAs with four uridine 3' overhangs efficiently suppress targeted gene expression in mammalian cells. Nat Biotechnol 2002;19:497-500.
  28. Yu JY, DeRuiter SL, Turner DL. RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad Sci USA 2002;99:6047-52.[Abstract/Free Full Text]
  29. Paddison PJ, Caudy AA, Hannon GJ. Stable suppression of gene expression by RNAi in mammalian cells. Proc Natl Acad Sci USA 2002;99:1443-8.[Abstract/Free Full Text]
  30. Paul CP, Good PD, Winer I, Engelke DR. Effective expression of small interfering RNA in human cells. Nat Biotechnol 2002;20:505-8.[CrossRef][Medline]
  31. Barlati S, Zoppi N, Copeta A, Tavian D, De Petro G, Colombi M. Quantitative in situ hybridization for the evaluation of gene expression in asynchronous and synchronized cell cultures and in tissue sections. Histol Histopathol 1999;14:1231-40.[Medline]
  32. Tavian D, De Petro G, Colombi M, et al. RT-PCR detection of fibronectin EDA+ and EDB+ mRNA isoforms: molecular markers for hepatocellular carcinoma. Int J Cancer 1994;56:820-5.[Medline]
  33. Copeta A, Tavian D, Marchina E, De Petro G, Barlati S. Gene response of human skin fibroblasts to urokinase and tissue-type plasminogen activators. Growth Factors 2000;17:249-68.[Medline]
  34. De Petro G, Tavian D, Marchina E, Barlati S. Induction of fibronectin mRNA by urokinase- and tissue-type plasminogen activator in human skin fibroblasts: different role of u-PA and t-PA at the fibronectin protein level. Biol Chem 2002;383:177-87.[Medline]
  35. Marchina E, De Petro G, Barlati S. Interaction of tissue-type plasminogen activators with fibronectin fragments. Fibrinolysis 1993;7:51-7.
  36. Padro T, Mesters RM, Dankbar B, et al. The catalytic domain of endogenous urokinase-type plasminogen activator is required for the mitogenic activity of platelet-derived and basic fibroblast growth factors in human vascular smooth muscle cells. J Cell Sci 2002;115:1961-71.[Abstract/Free Full Text]
  37. Jensen PJ, Lavker RM. Urokinase is a positive regulator of epidermal proliferation in vivo. J Invest Dermatol 1999;112:240-4.[CrossRef][Medline]
  38. Tavian D, De Petro G, Benetti A, Portolani SM, Barlati S. u-PA and c-met mRNA expression is co-ordinately enhanced while hepatocyte growth factor mRNA is down-regulated in human hepatocellular carcinoma. Int J Cancer 2000;87:644-9.[Medline]
  39. Koscioiek BA, Kaiantidis K, Tabler M, Rowley PT. Inhibition of telomerase activity in human cancer cells by RNA interference. Mol Cancer Ther 2003;2:209-16.[Abstract/Free Full Text]
  40. Caplen NJ. RNAi as a gene therapy approach. Exp Opin Biol Ther 2003;3:575-86.[CrossRef]
  41. Brennecke J, Cohen SM. Towards a complete description of the microRNA complement of animal genomes. Genome Biol 2003;4:228-228.3.[CrossRef][Medline]
  42. Lieberman J, Song E, Lee S-K, Shankar P. Interfering with disease: opportunities and roadblocks to harnessing RNA interference. Trends Mol Med 2003;9:397-403.[CrossRef][Medline]
  43. Shetty S, Idell S. Urokinase induces expression of its own receptor in Beas2B lung epithelial cells. J Biol Chem 2001;276:24549-56.[Abstract/Free Full Text]
  44. Montuori N, Mattiello A, Mancini A, et al. Urokinase-type plasminogen activator up-regulates the expression of its cellular receptor through a post-transcriptional mechanism. FEBS Lett 2001;508:379-84.[CrossRef][Medline]
  45. Yu W, Kim J, Ossowski L. Reduction in surface urokinase receptor forces malignant cells into a protracted state of dormancy. J Cell Biol 1997;137:767-77.[Abstract/Free Full Text]
  46. Shetty S, Kumar A, Johnson A, Pueblitz S, Idell S. Urokinase receptor in human malignant mesothelioma cells: role in tumor cell mitogenesis and proteolysis. Am J Phys 1995;268:972-82.
  47. Schmitt M, Harbeck N, Thomssen C, et al. Clinical impact of the plasminogen activation system in tumor invasion and metastasis: prognostic relevance and target for therapy. Thromb Haemost 1997;78:285-96.[Medline]
  48. Li K, Lin SY, Brunicardi FC, Seu P. Use of RNA interference to target cyclin E-overexpressing hepatocellular carcinoma. Cancer Res 2003;63:3593-7.[Abstract/Free Full Text]
  49. Wilson JA, Jayasena S, Khvorova A, et al. RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells. Proc Natl Acad Sci USA 2003;100:2783-8.[Abstract/Free Full Text]
  50. Hamasaki K, Nakao K, Matsumoto K, Ichikawa T, Ishikawa H, Educhi K. Short interfering RNA-directed inhibition of hepatitis B virus replication. FEBS Lett 2003;543:51-4.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
S. M. K. Pulukuri, B. Gorantla, and J. S. Rao
Inhibition of Histone Deacetylase Activity Promotes Invasion of Human Cancer Cells through Activation of Urokinase Plasminogen Activator
J. Biol. Chem., December 7, 2007; 282(49): 35594 - 35603.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
M. Zhu, V. M. Gokhale, L. Szabo, R. M. Munoz, H. Baek, S. Bashyam, L. H. Hurley, D. D. Von Hoff, and H. Han
Identification of a novel inhibitor of urokinase-type plasminogen activator
Mol. Cancer Ther., April 1, 2007; 6(4): 1348 - 1356.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. M. K. Pulukuri, N. Estes, J. Patel, and J. S. Rao
Demethylation-Linked Activation of Urokinase Plasminogen Activator Is Involved in Progression of Prostate Cancer
Cancer Res., February 1, 2007; 67(3): 930 - 939.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
R. J. Epstein and T. W. Leung
Reversing Hepatocellular Carcinoma Progression by Using Networked Biological Therapies
Clin. Cancer Res., January 1, 2007; 13(1): 11 - 17.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. M. Pulukuri, C. S. Gondi, S. S. Lakka, A. Jutla, N. Estes, M. Gujrati, and J. S. Rao
RNA Interference-directed Knockdown of Urokinase Plasminogen Activator and Urokinase Plasminogen Activator Receptor Inhibits Prostate Cancer Cell Invasion, Survival, and Tumorigenicity in Vivo
J. Biol. Chem., October 28, 2005; 280(43): 36529 - 36540.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Salvi, A.
Right arrow Articles by Barlati, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Salvi, A.
Right arrow Articles by Barlati, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online