Molecular Cancer Therapeutics  AM No Date
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hayward, R. L.
Right arrow Articles by Jodrell, D. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hayward, R. L.
Right arrow Articles by Jodrell, D. I.
Mol Cancer Ther. 2004;3:169-178
© 2004 American Association for Cancer Research

Enhanced oxaliplatin-induced apoptosis following antisense Bcl-xl down-regulation is p53 and Bax dependent: Genetic evidence for specificity of the antisense effect

Richard L. Hayward1, Janet S. Macpherson1, Jeff Cummings1, Brett P. Monia2, John F. Smyth1 and Duncan I. Jodrell1

1 Edinburgh Oncology Unit, Cancer Research UK, Edinburgh, United Kingdom and 2 Isis Pharmaceuticals, Inc., Carlsbad, CA

Requests for Reprints:Richard L. Hayward, Edinburgh Oncology Unit, Cancer Research UK, Western General Hospital, Crewe Road South, Edinburgh EH4 2XR, United Kingdom. Phone: 44-131-777-3558; Fax: 44-131-777-3520. E-mail: r.hayward{at}cancer.org.uk


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Introduction: Oxaliplatin, licensed for colorectal cancer chemotherapy, damages DNA by generating intrastrand and interstrand cross-links and can induce apoptosis via a Bax-dependent pathway. Bcl-xl, an antiapoptotic Bcl-2 family member, regulates apoptosis and chemoresistance in several cancer models. Bcl-xl expression correlates with invasiveness in primary colorectal cancer. Bcl-xl may therefore represent a therapeutic target in this disease. We used the mismatch repair-deficient HCT116 colorectal cancer cell line (wild-type HCT116) and p53 null, Bax null, or p21/WAF1 null derivatives to identify genetic determinants of the response to oxaliplatin and tested the hypothesis that antisense-mediated Bcl-xl down-regulation would enhance the apoptotic response in a p53- or Bax-dependent manner. Results: At clinically relevant concentrations, oxaliplatin induced p53 and p53-dependent Bax, Bcl-xl, and p21/WAF1 protein accumulation. A minor degree of apoptosis resulted via a p53- and Bax-dependent pathway. The major response was a transient mixed G1 and G2 growth arrest. The G1 arrest was p53 and p21/WAF1 dependent. A 2'-O-ribose methoxyethyl phosphorothioate antisense oligonucleotide reduced Bcl-xl protein expression by ~90% in HCT116 (Bcl-xl knockdown). Missense controls were inactive. Prior Bcl-xl knockdown enhanced the apoptotic and the global cytotoxic effect of oxaliplatin. The extent of enhancement of apoptosis depended on the integrity of the p53- and Bax-mediated apoptotic pathway, providing genetic evidence that the desired proapoptotic antisense effect is due to specific down-regulation of the Bcl-xl target. Conclusion: The combination of oxaliplatin and Bcl-xl antisense merits testing in models of colorectal cancer in vivo.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Oxaliplatin, a diaminocyclohexane platinum, is licensed in Europe and the United States for colorectal cancer chemotherapy, in which disease it has greater clinical activity than cisplatin (1). Prediction or enhancement of oxaliplatin tumoricidal effect based on knowledge of cellular response determinants could improve the clinical utility of the drug. In this study, we identify several such response determinants, and use antisense technology to enhance oxaliplatin activity in vitro, by down-regulation of the antiapoptotic Bcl-2 family member Bcl-xl. Our data demonstrate for the first time that the extent of proapoptotic action of an antisense oligonucleotide depends on the genetic integrity of the relevant apoptotic pathway (in this case the p53- and Bax-mediated pathway), thereby providing strong evidence that the desired proapoptotic effect is due to down-regulation of the target (in this case Bcl-xl).

Oxaliplatin damages DNA by generating intrastrand and interstrand cross-links similar to those induced by cisplatin (1) and repaired with similar efficiency by the nucleotide excision repair machinery (2). However, the bulky diaminocyclohexane group alters the recognition of oxaliplatin adducts by other downstream mediators of the cellular response (3). For example, mismatch repair deficiency due to mutation of hMLH1 in the colorectal cancer cell line HCT116 confers an increase in replicative bypass of cisplatin DNA adducts and resistance to cisplatin-induced cytotoxicity but does not influence replicative bypass or sensitivity to oxaliplatin adducts (4, 5). Mismatch repair deficiency confers clinically significant resistance to cisplatin but not to oxaliplatin chemotherapy, so that oxaliplatin may be particularly useful in the therapy of mismatch repair-deficient colorectal cancer (1).

Members of the p53 tumor suppressor gene family also regulate the response of colorectal cancer cells to cytotoxic treatment in vitro (6–8). In general, two competing p53-mediated responses are observed: cell death or cell cycle arrest (9, 10). Additional genes have been identified, the expression of which regulates these competing p53-mediated responses in a manner dependent on the nature of the cytotoxic drug. Thus, abrogation of cell cycle arrest by knockout of either p53 or p21/WAF1 or 14-3-3{sigma} genes in HCT116 colorectal cancer cells can alter the balance of cellular response to doxorubicin from arrest to mitotic death (11–14) via a p53-independent pathway. In contrast, 5-fluorouracil (5FU) induces apoptosis in a p53-dependent manner via the mitochondrial apoptotic pathway, despite intact cell cycle checkpoint machinery (9, 10). The effect of p53 disruption on chemosensitivity therefore depends on the nature of the cytotoxic drug and on the status of repair mechanisms, cell cycle checkpoints, and apoptotic signaling pathways. In fact, the role of genetic drug response determinants depends in general on the genetic context. Therefore, study of such determinants is best performed on a well-defined isogenic background.

Proapoptotic proteins regulated by p53 include Bik, Bak, and PUMA as well as Bax (15–21). Each of these proapoptotic Bcl-2 family proteins localizes to mitochondria and can heterodimerize through a BH3 domain with antiapoptotic Bcl-2 family members, like Bcl-xl (16, 17). The ratio of proapoptotic to antiapoptotic Bcl-2 family members helps to determine the threshold for induction of mitochondrial-dependent apoptosis (18–21). For example, Bax null cells are profoundly resistant to apoptosis driven by nonsteroidal anti-inflammatory drugs and are partly resistant to 5FU-driven apoptosis (22). In mismatch repair-deficient HCT116 cells, microsatellite instability at the Bax locus with consequent loss of Bax expression has been identified as a mechanism of acquired oxaliplatin resistance in vitro (23). On the other hand, overexpression of exogenous Bcl-xl suppresses mitochondrial-mediated apoptosis and enhances cancer cell survival in several cancer models (24–30). In an extensive study of genetic determinants of chemosensitivity in the NCI-60 cancer cell line panel, Bcl-xl expression was identified as the strongest correlate of chemoresistance across 122 standard chemotherapeutics (31).

Human colonic adenomas overexpress Bcl-2 relative to surrounding normal mucosa (32, 33). Associated with the transition to invasive malignancy, Bcl-2 expression tends to fall and elevated Bcl-xl expression appears (34–37), and this transition indicates worsening prognosis (38, 39). Down-regulation of Bcl-xl might be expected to increase the apoptotic response to DNA damage in invasive colorectal cancer. Indeed, antisense Bcl-xl down-regulation (Bcl-xl knockdown) has been shown to increase 5FU-induced apoptosis in colorectal cancer cells in vitro (40). Genetic determinants of this effect were not identified. Bcl-xl or Bcl-2 antisense oligonucleotides also enhance the effect of chemotherapy in a variety of other tumor types in vitro and in vivo (41–46). Bcl-2 antisense oligonucleotides are undergoing clinical trials in melanoma and lymphoma (47–49).

Both p53 and Bax are frequent targets of genetic disruption in particular subtypes of human colorectal cancer, and their disruption has a negative prognostic impact on patient survival (50, 51). Elucidation of their role in determining chemotherapeutic response should therefore contribute to more effective clinical use of oxaliplatin in colorectal cancer therapy. We used an isogenic set of colorectal cancer cell lines derived from HCT116 to investigate these determinants of response to oxaliplatin alone or in combination with antisense-mediated Bcl-xl knockdown (45). The parental HCT116 line carries wild-type p53, p21/WAF1, and Bax and is mismatch repair deficient. The derivative lines we used differ from the parental line by virtue of selective knockout of p53, p21/WAF1, or Bax by targeted homologous recombination (22, 52).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Lines and Tissue Culture
The p53 null, p21/WAF1 null, or Bax null derivatives of the wild-type HCT116 (HCT116-wt) cell line, generated by targeted homologous recombination, were a generous gift from B. Vogelstein (Johns Hopkins Oncology Center, Baltimore, MD). Immunoblots confirmed the expected lack of expression of p53, p21/WAF1, or Bax, respectively (data not shown). HCT116, HT29, LoVo, SW48, and HT115 colorectal cancer cell lines were also obtained from the European Collection of Cell Cultures. Cell lines were maintained in RPMI 1640 with 10% FCS and 1% penicillin/streptomycin (all from Life Technologies, Inc., Carlsbad, CA) in a 37°C, 5% CO2, fully humidified incubator and passaged once or twice weekly.

Oligonucleotides
Oligonucleotides with 2'-O-methoxyethyl modification of the ribose ring in flanking nucleotides and a fully phosphorothioate backbone were provided by Isis Pharmaceuticals, Inc. (Carlsbad, CA). The antisense agent ISIS 15999 (TCCCGGTTGCTCTGAGACAT) is complementary to the first 20 Bcl-xl coding nucleotides. An 8-bp mismatched oligonucleotide ISIS 16971 (TCACATTGGCGCTTAGCCGT) provided a missense control. Opti-MEM 1 was preincubated for 45 min at room temperature (RT) with lipofectin (Life Technologies) in the ratio of 3 µl/ml lipofectin/400 nM final oligonucleotide concentration. Oligonucleotides were added and the mixture was incubated for a further 15 min at RT before transfections were performed in triplicate on six-well trays containing 0.75–1.25 x 106 cells/well by washing with 1 ml PBS (pH 7.5), adding 1 ml of transfection mix, and incubating for 6 h. To obtain quantitatively reproducible results, it proved essential to closely control the number of cells present on the day of treatment.

Oxaliplatin Treatment
Oxaliplatin (a gift of Sanofi-Synthelabo, Paris, France) was dissolved in sterile distilled water at 0.25 mg/ml and was used fresh. Treatment solutions were made by serial dilution. Drug-containing growth media was incubated with cells for 24 h and then replaced with drug-free media, which, for prolonged experiments, was replenished on days 3 and 7.

Growth Assays by Coulter Counting
Adherent cells were washed in PBS and harvested in trypsin/EDTA (Life Technologies), growth medium was added, single cell suspensions were made by three passages through a 22-gauge needle, and 200 µl aliquots were added to 9.8 ml 0.9% saline and counted in a Z2 Coulter counter.

Clonogenic Assays
For each cell line, 300–600 cells were plated overnight in 25-cm2 flasks and then incubated for 24 h in drug-containing media and for a further 16–18 days in drug-free media. Visible colonies were then fixed (2 min in 2 ml of 2:1 acetone/methanol), stained with hematoxylin, and counted.

Immunoblots
For actin, p53, p21/WAF1, Bax, Bcl-2, and Bcl-xl immunoblots, pellets of adherent cells were washed with cold PBS, stored at –20°C, resuspended in 100 µl lysis buffer [50 mM HEPES (pH 7.4), 1% Triton X-100, 0.5% sodium deoxycholate, 150 mM sodium chloride, 5 mM EDTA with protease inhibitors pepstatin A (2 µg/ml), aprotinin (10 µg/ml), leupeptin (10 µg/ml), and phenylmethylsulfonyl fluoride (100 µg/ml)] per 1 million cells, and mixed for 25 min at 4°C. Lysate supernatants were subjected to a Bradford assay for protein concentration. Twenty-microgram aliquots of total protein were denatured in loading buffer (95°C, 5 min), electrophoresed on a 10% SDS-PAGE gel, and transferred to a polyvinylidene fluoride Immobilon-P transfer membrane (Millipore, Billerica, MA). Protein loadings were checked by Ponceau staining. Membranes were blocked in 5% fat-free milk powder (Marvel, Premier Brands, St. Albans, United Kingdom) in Tris-buffered saline (TBS; pH 7.5) with 0.1% Tween 20 (TBS-T) for 1 h at RT, incubated with primary antibody in 5% Marvel in TBS-T (1 h at RT for actin, p53, Bcl-xl, Bcl-2, and Bax or overnight at 4°C for p21/WAF1), washed in TBS-T, and incubated with secondary antibody conjugated to horseradish peroxidase (1 h at RT). After further washing in TBS-T and TBS, blots were visualized by chemiluminesence (Santa Cruz Biotechnology, Santa Cruz, CA) and photographed. Actin immunoblots confirmed near-equal protein loading per lane. Expression for each protein was quantified by measuring the appropriate integrated absorbance (IOD) using Labworks software (UVP, Inc., Upland, CA). The IOD for each band was corrected for variations in protein loading (which were small) using the corresponding IOD for the actin band. For each independent experiment and for each protein band of interest, the corrected IOD derived for that band was expressed as a proportion of the total IOD obtained for that band summed for all samples. The mean and SE for the proportion of protein expression in drug-treated cells compared with untreated cells were thus derived from at least three independent experiments, each in duplicate. These results were normalized to give a mean value of 1 for each protein in untreated cells.

Poly(ADP-ribose) polymerase (PARP) immunoblots were used to detect caspase-mediated PARP cleavage during apoptosis. Floating and adherent cells were pooled and counted, washed in PBS, ultrasonicated on ice in a volume of reducing loading buffer proportional to the cell count [62.5 mM Tris (pH 6.8), 6 M urea, 10% glycerol, 2% SDS, 0.003% bromophenol blue, 5% 2-mercaptoethanol], and electrophoresed on a 7.5% gel. Ponceau staining and actin immunoblotting confirmed near-equal protein loadings. PARP immunoblotting followed the protocol above (substituting PBS for TBS at each step) using the antibodies outlined below. The IOD of uncleaved and cleaved PARP bands was measured using Labworks software (UVP), and the extent of cleavage was expressed as the ratio of cleaved to total PARP. The mean and SE for this ratio were derived from at least three independent experiments for each treatment condition.

Antibodies were as follows: mouse ascites monoclonal anti-actin IgM CP01 (1:120,000), mouse monoclonal anti-p53 IgG OP43 (1:200), mouse monoclonal anti-p21/WAF1 IgG OP64 (1:100), and mouse monoclonal anti-Bcl-2 IgG OP60 (1:100) all from Oncogene Research Products (San Diego, CA), rabbit polyclonal anti-Bcl-xl IgG sc-634 (1:200) and rabbit polyclonal anti-Bax IgG sc-493 (1:500) both from Santa Cruz Biotechnology, and mouse monoclonal anti-PARP C2-10 (1:10,000) from R&D Systems, Inc. (Minneapolis, MN). Secondary antibodies were goat anti-mouse IgM 401225 (1:4000) from Calbiochem (La Jolla, CA) and goat anti-rabbit IgG sc-2030 (1:2000) and goat anti-mouse IgG sc-2031 (1:2000) both from Santa Cruz Biotechnology.

Cell Cycle Analysis
One million cells were washed in cold PBS, fixed in 70% ethanol (at least 1 h at 4°C), washed, resuspended in 25 µg/ml propidium iodide (PI) with 100 µg/ml RNaseA (Sigma-Aldrich, Dorset, United Kingdom), and incubated for 30 min at 37°C. Fluorescence was measured on a FACSCaliber flow cytometer (Becton Dickinson, Oxford, United Kingdom) within 1 h. Data were analyzed using the ModFit 2.0 program (Verity Software, Topsham, ME). The mean and SE for the percentage of cells in each phase of the cell cycle were derived from at least three independent experiments, each in duplicate. For analysis of growth arrest, adherent cells only were harvested. For determination of sub-G1 fraction, adherent and floating cells were pooled.

Annexin V Assays
One million cells were washed in cold PBS, suspended in 100 µl Annexin V binding buffer containing 5 µg/ml PI and 0.5 µg/ml Annexin V-FITC, incubated for 15 min at RT in the dark, and diluted in 400 µl Annexin V binding buffer (R&D Systems). Fluorescence was measured on a FACSCaliber flow cytometer (Becton Dickinson) within 1 h. The collected events were gated on the forward and side scatter plots to exclude cellular debris. Three discrete cell populations identified using standard cutoffs in each experiment represented viable (unstained), early apoptotic (Annexin V but no PI staining), and late apoptotic/necrotic cells (Annexin V and PI staining). The mean and SE for the proportion of early apoptotic cells were thus derived from at least three independent experiments, each in duplicate.

Definition of Supraadditive Enhancement of Response in Growth Inhibition Assays
Single-agent dose response curves were measured in at least three independent experiments each in duplicate for antisense oligonucleotide (6-h exposure to 0, 400, 800, 1600, or 4800 nM) or for oxaliplatin (0, 4, 8, or 16 µM for 24 h), with counts of adherent cell numbers at 96 h. The dose response curves were concave upward. Therefore, in the nomenclature of Steel and Peckham (53), the mode I expected combination effect defines the appropriate limit of the envelope of additivity at every level of effect and is calculated by multiplication of the corresponding single-agent effects.

Combination experiments were performed at fixed antisense exposure (0 or 400 nM for 6 h) followed by oxaliplatin (0, 4, or 8 µM for 24 h) with counts at 96 h. For each experiment, the mode I expected combination effects could therefore be calculated. The mean and SE measured or expected combination effects were thus derived from six independent experiments, each in triplicate. The true measured combination effect was classified as supraadditive if greater than the expected combination effect by a statistically significant margin. Lipofectin/oxaliplatin or missense/oxaliplatin combination experiments excluded supraadditive interactions between these agents.

Statistical Analysis
The significance of differences between experimental conditions was determined using the two-tailed Student's t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
p53, Bax, and p21/WAF1 Are Determinants of Response to Oxaliplatin
The extent of oxaliplatin cytotoxicity was p53 dependent in clonogenic assays at 2.5 weeks (Fig. 1A) or in short-term growth assays (Fig. 1B; note: throughout the paper, day 0 refers to the start of oxaliplatin treatment). Bax null cells demonstrated sensitivity comparable with that of HCT116-wt cells. On the other hand, p21/WAF1 null cells were significantly more sensitive to oxaliplatin treatment (Fig. 1, A and B). HCT116-wt cells underwent a prolonged dose-dependent growth arrest, lasting up to 7 days, but remained adherent and thereafter began again to divide. In contrast, p53 null cells recovered from a brief growth delay within 2 days, whereas p21 null cells underwent delayed cell death maximal after day 4 (Fig. 1C). To elucidate the mechanisms of the p53 and p21/WAF1 dependence of cytotoxicity and the extent to which growth arrest or apoptosis contributed, we compared these responses in HCT116-wt cells or in p53 null, Bax null, or p21/WAF1 null derivatives. Oxaliplatin (4 or 8 µM) induced a marked fall in S phase by day 2 in HCT116-wt, with the growth-arrested population partitioned equally between G1 and G2. The S-phase fraction remained suppressed for up to 7 days (data not shown). Bax null cells behaved similarly. In contrast, p53 null or p21/WAF1 null HCT116 cells accumulated in G2, with only ~2-fold falls in both S and G1 fractions, indicating failure of the G1 component of the growth arrest (Fig. 1D).



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Oxaliplatin cytotoxicity and growth arrest are p53 and p21/WAF1 dependent. Cells were treated in triplicate with oxaliplatin for 24 h in at least three independent experiments for each condition. A, clonogenic assays for wild-type, p53 null, p21/WAF1 null, or Bax null cell lines performed 2.5 weeks after treatment. B, cell counts for wild-type, p53 null, p21/WAF1 null, or Bax null cell lines 72 h (day 3) after start of oxaliplatin treatment. C, growth curves for wild-type, p53 null, or p21/WAF1 null HCT116 treated with 4 or 8 µM oxaliplatin, illustrating the early recovery of growth for the p53 null line. Bax null cells behaved similarly to wild-type cells. For clarity, the time course for each condition is truncated at the last time point before the onset of growth inhibition due to confluence. Wells were replenished with fresh drug-free media on days 3 and 7. D, cell cycle distribution by flow cytometry 48 h (day 2) after the start of oxaliplatin treatment. Adherent cells only were harvested.

 
Although a growth arrest was the dominant response to oxaliplatin, apoptosis in HCT116-wt or p21/WAF1 null cells was also demonstrable by Annexin V apoptosis assays (Fig. 2A), by the appearance of a population of cells with sub-G1 DNA content (Fig. 2B), and by the onset of PARP cleavage (Fig. 2C). The precise extent of apoptosis measured varied depending on the assay used. For example, 8 µM oxaliplatin induced 2 ± 1% PARP cleavage in wild-type cells by day 2, but 11 ± 2% of these cells demonstrated early apoptotic changes by the Annexin V assay at the same time point. We attribute these differences to the fact that each assay detects a different aspect of apoptosis (early and potentially reversible phosphatidyl serine exposure for Annexin V and late caspase activation for PARP cleavage; 54). Nevertheless, in each case, less apoptosis was detected in p53 null or Bax null cells than in HCT116-wt or p21/WAF1 null cells, indicating that oxaliplatin can induce apoptosis via a p53- and Bax-dependent pathway.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Oxaliplatin-induced apoptosis can occur via p53- and Bax-dependent pathway. Floating and adherent cells were pooled. A, 1 million cells harvested 48 h (day 2) after the start of a 24-h oxaliplatin treatment were incubated in Annexin V binding buffer containing PI and Annexin V-FITC. Fluorescence was measured on a flow cytometer within 1 h. Points, mean for the proportion of cells in early apoptosis (Annexin V but no PI staining) derived from at least three independent experiments; bars, SE. B, cell cycle distributions determined by flow cytometry on day 2 demonstrate the extent of a sub-G1 fraction in oxaliplatin-treated cells. C, cells harvested on days 1, 2, 3, and 4 (day 1 is the end of oxaliplatin treatment) were ultrasonicated in a volume of reducing loading buffer proportional to the cell count. Aliquots were immunoblotted to detect PARP cleavage. Representative photographs of gels are shown.

 
Immunoblots demonstrated oxaliplatin-induced accumulation of p53, p21/WAF1, Bax, and Bcl-xl protein in HCT116-wt cells (Fig. 3A). The accumulation of p21/WAF1 was p53 dependent. Both Bax and Bcl-xl expression could be detected in p53 null HCT116, but accumulation following oxaliplatin occurred to a significantly lesser extent than in HCT116-wt (Fig. 3B). In either case, the Bax/Bcl-xl ratio changed little.



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Oxaliplatin induces accumulation of p53, p21/WAF1, Bax, and Bcl-xl. Lysates from HCT116-wt or p53 null cells treated with 0 or 8 µM oxaliplatin were subjected to immunoblot analysis for actin, p53, p21/WAF1, Bcl-xl, or Bax. Blots were visualized by chemiluminesence and photographed. Ponceau staining and results for actin confirmed equal protein loadings. A, representative photographs of gels. B, columns, mean for three or four independent repeats of these immunoblot experiments for which the IODs of the relevant bands were corrected for the corresponding actin IOD and normalized to the untreated state; bars, SE. Data for the cells harvested at the end of a 24-h oxaliplatin exposure (day 1) and 24 h later (day 2).

 
Bcl-xl Expression in Colorectal Cancer Cell Lines of Diverse Genotype Can Be Down-Regulated by Bcl-xl Antisense in Vitro
To test the hypothesis that Bcl-xl expression in HCT116-wt cells suppressed p53- and Bax-dependent apoptosis following oxaliplatin treatment, we sought to down-regulate Bcl-xl protein expression using ISIS 15999, a Bcl-xl antisense oligonucleotide. In HCT116, antisense-mediated Bcl-xl protein down-regulation (Bcl-xl knockdown) was evident within 24 h and lasted at least 72 h after a 6-h treatment with 200 nM antisense oligonucleotide (Fig. 4A). At 48 h, the degree of Bcl-xl knockdown was 89 ± 3% (n = 3, P < 0.01). Lipofectin and missense controls had no significant effect. Dose dependence of protein knockdown was demonstrable at 24 h (Fig. 4A). Bcl-xl knockdown occurred to a similar extent with or without oxaliplatin treatment in HCT116-wt or p53 null cells, no alteration of Bcl-2 expression was detected (Fig. 4B), and Bax expression was not affected (data not shown). Expression of Bcl-xl protein was also down-regulated to varying degrees by antisense (but not missense) treatment in a total of five independent colorectal cancer cell lines (Fig. 4C). These cell lines (LoVo, SW48, HT115, HT29, and HCT116) are of diverse genotype, spanning the major subtypes described in colorectal cancer (55).



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Bcl-xl antisense specifically down-regulates Bcl-xl protein expression in various colorectal cancer cell lines. Cells were treated with Opti-MEM 1 alone (C), with lipofectin (L), or with lipofectin and missense (M) or antisense (A) at 50 or 200 nM followed by 0 or 8 µM oxaliplatin. Lysates were subjected to immunoblot analysis for p53, Bcl-2, Bcl-xl, or actin. Blots were visualized by chemiluminesence and photographed. A, duration and dose dependence of Bcl-xl down-regulation in HCT116. B, Bcl-xl down-regulation and lack of effect on p53 or Bcl-2, with or without oxaliplatin treatment, in HCT116-wt or p53 null HCT116. C, Bcl-xl knockdown in HT29, HT115, LoVo, and SW48.

 
Prior Bcl-xl Knockdown Increases Oxaliplatin-Induced Apoptosis and Global Cytotoxicity
We used the isogenic panel of HCT116 cell lines to determine the p53 and Bax dependence of the effect of Bcl-xl knockdown on apoptosis and on global oxaliplatin cytotoxicity (the net effect of cell cycle arrest and cell death). In HCT116-wt cells, Bcl-xl knockdown alone did not induce apoptosis but markedly increased the extent of apoptosis following oxaliplatin treatment as indicated by the degree of PARP cleavage (Fig. 5; Table 1). Missense and lipofectin controls were inactive. Bcl-xl knockdown alone induced some apoptosis in HCT116 p21/WAF1 null cells and further increased oxaliplatin-induced apoptosis in these cells. In contrast, the degree of oxaliplatin-induced apoptosis after Bcl-xl knockdown was significantly less in Bax null cells than in HCT116-wt or p21/WAF1 null cells (P < 0.01). Oxaliplatin induced no significant apoptosis in p53 null cells even after Bcl-xl knockdown (Fig. 5; Table 1). Thus, Bcl-xl knockdown increased oxaliplatin-induced apoptosis in a p53-dependent fashion and the absolute extent of increase was dependent on Bax status.



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. p53 and Bax are determinants of the effect of antisense-mediated Bcl-xl knockdown on oxaliplatin-induced apoptosis. HCT116-wt, p53 null, Bax null, or p21/WAF1 null cells were treated with Opti-MEM 1 alone (C) or with lipofectin and missense (M) or antisense (A) oligonucleotides (400 nM) followed by 0 or 8 µM oxaliplatin for 24 h. Floating and adherent cells were harvested 48 h after the start of oxaliplatin treatment and ultrasonicated on ice in a volume of reducing loading buffer proportional to the cell count. Aliquots were subjected to immunoblot analysis for actin or PARP. Blots were visualized by chemiluminesence and photographed. Ponceau staining and results for actin confirmed near-equal protein loadings. Columns, mean for at least three independent experiments for which the degree of PARP cleavage was expressed as the ratio of the IOD for cleaved PARP relative to the total IOD for cleaved and uncleaved PARP; bars, SE.

 

View this table:
[in this window]
[in a new window]

 
Table 1. Mean (SE) for ratio of cleaved to total PARP

 
For these experiments, we preferred the PARP cleavage apoptotic assay over the Annexin V assay because a significant number of late apoptotic cells accumulate by day 2 (mainly in the floating cell fraction). The Annexin V assay does not discriminate these late apoptotic cells from necrotic cells, whereas the PARP cleavage assay is specific for apoptosis. Nevertheless, to confirm the results of the PARP cleavage assays, we used the Annexin V assay to measure onset of early apoptotic changes in adherent HCT116-wt cells following combination treatment. Again, Bcl-xl knockdown increased the rate of oxaliplatin-induced apoptosis (Fig. 6).



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Annexin V apoptosis assay corroborates PARP cleavage results in HCT116-wt cells. HCT116-wt cells were treated with Opti-MEM 1 alone (C), with lipofectin (L), or with lipofectin and missense (M) or antisense (A) oligonucleotides (400 nM) followed by 0, 4, or 8 µM oxaliplatin for 24 h. One million adherent cells were harvested 48 h after the start of oxaliplatin treatment and incubated in Annexin V binding buffer containing PI and Annexin V-FITC. Fluorescence was measured on a flow cytometer within 1 h. Columns, mean for the proportion of cells in the early stages of apoptosis (Annexin V but no PI staining) derived from three independent experiments; bars, SE.

 
Finally, Bcl-xl knockdown produced a supraadditive increase of global cytotoxicity of oxaliplatin in HCT116-wt as assayed by surviving cell counts at 96 h (Fig. 7; P < 0.01 for comparison of observed with expected combination effect).



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7. Antisense Bcl-xl knockdown results in supraadditive enhancement of oxaliplatin activity. HCT116-wt cells were treated with Opti-MEM 1 alone (control), with lipofectin, or with lipofectin and missense or antisense oligonucleotides (400 nM) followed by return to growth media with 0, 4, or 8 µM oxaliplatin for 24 h. Forty-eight or 96 hours after the start of oxaliplatin treatment, adherent cells were harvested and counted. The surviving proportion of cells for each treatment, with each dose of oxaliplatin, was expressed relative to the surviving number of cells treated with Opti-MEM 1 and the corresponding dose of oxaliplatin. Points, mean for six independent experiments harvested at 96 h; bars, SE. Similar results were obtained at 48 h.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
As the p53 null, or p21/WAF1 null or Bax null HCT116 derivatives (22, 52) were each generated in a well characterized fashion from parental HCT116-wt, they have allowed us to identify genetic determinants (either p53, or p21/WAF1 or Bax) of the effect of oxaliplatin and of Bcl-xl knockdown on an otherwise isogenic background, and therefore in a well controlled fashion.

In clonogenic assays (which involve drug treatment of cells growing at very low density), 4 µM oxaliplatin approached the IC90 for HCT116-wt cells. If evaluated at 3 days, short-term growth assays (involving treatment of cells growing at higher density) yielded very similar inhibitory concentrations. However, when analyzed for apoptosis, 8 µM oxaliplatin yielded only 2–11% apoptosis in HCT116-wt cells depending on the method of the assay. In long-term growth assays, around 90% of HCT116-wt cells survived, and this lack of cell death was reflected in a lack of any significant net fall in cell number over time (Fig. 1C). In fact, the majority of HCT116-wt cells treated at 4 or 8 µM oxaliplatin underwent a prolonged growth arrest, lasting up to 7 days, but thereafter resumed robust growth. HCT116 p53 null cells recovered even earlier. We studied the p53 dependence of this behavior in detail at the 4 or 8 µM concentrations of oxaliplatin because these generated robust experimental data and are within 2-fold of oxaliplatin serum concentrations, which can be achieved clinically. These range from 2 to 4 µM depending on the regime (56, 57). We wished to avoid a pitfall of in vitro work (i.e., the generation of dramatic effects by the use of drug concentrations so high as to be irrelevant to clinical practice). Nevertheless, we have been able to draw statistically sound conclusions by careful quantitation of our data. For precise quantitation of the extent of apoptosis, we used the PARP cleavage assay (54) in preference to measurement of the sub-G1 fraction or to the Annexin V assay. The sub-G1 assay does not readily detect cells dying from the G2 phase of the cell cycle. The Annexin V assay detects early apoptotic changes specifically but cannot discriminate late apoptotic from necrotic cells. Nevertheless, both of these apoptosis assays provided useful confirmation of our more detailed PARP cleavage results. Indeed, the PARP cleavage assay has been shown to correlate well with other measures of apoptosis in vitro and in vivo (54).

Clonogenic survival assays do not readily discriminate delay of clonogenicity due to prolonged growth arrest from elimination of clones due to cell death. The interpretation of clonogenic survival assays is therefore facilitated by parallel assays of growth arrest and apoptosis. At 8 µM oxaliplatin, the dominant cellular response in HCT116-wt cells was a prolonged mixed G1 and G2 growth arrest. Bax null cells behaved similarly. The arrest was associated with accumulation of p53 and of the cell cycle inhibitor p21/WAF1 in a p53-dependent manner. The G1 component of growth arrest was p53 and p21/WAF1 dependent, and p53 null or p21/WAF1 null cell lines underwent a transient G2 arrest only. Thus, in HCT116-wt cells, growth remained suppressed for up to 7 days but recovered within 4 days for p53 null cells. The observed difference in clonogenic survival for HCT116-wt and p53 null cells, apparent when measured at 2.5 weeks, may therefore be attributed in part to a failure to detect small, late recovering HCT116-wt clones.

On the other hand, p21/WAF1 null cells demonstrated greater sensitivity to oxaliplatin than HCT116-wt or p53 null cells. Increased rates of apoptosis in p21/WAF1 cells were observed up to day 4, the last time point at which we directly measured apoptosis, and cell death continued beyond this time point, leading to a detectable net fall in total cell counts from day 4 onwards in prolonged growth assays. Thus, p21/WAF1 null cells ultimately die rather than resume cell division. Therefore, the prolonged p21/WAF1-dependent G1 arrest protects HCT116-wt cells from oxaliplatin-induced cell death. We hypothesize that the prolonged G1 growth arrest allows definitive repair of oxaliplatin damage, which, if unrepaired, signals for cell death via a p53-dependent mechanism on resumption of cell division. This model also explains the very different ultimate destiny of p21/WAF1 null and p53 null cells (death and recovery, respectively) despite their similar cell cycle behavior. Direct evidence for ongoing repair during the G1 arrest awaits future study.

During their growth arrest, only a small fraction of HCT116-wt cells underwent apoptosis. Nevertheless, Bax null and p53 null cells demonstrated less apoptosis than HCT116-wt cells (Figs. 2 and 5; Table 1), suggesting that oxaliplatin could induce apoptosis via a p53- and Bax-dependent pathway but that this apoptotic pathway was suppressed by an unknown mechanism. We sought to elucidate this mechanism. Accumulation of the proapoptotic protein Bax was induced by oxaliplatin treatment. Bax expression is under the transcriptional control of p53 (58), and Bax was induced to a greater degree in parental HCT116-wt than in p53 null HCT116. However, Bcl-xl protein accumulation was also induced by oxaliplatin treatment such that the Bax/Bcl-xl ratio changed little. The accumulation of both Bax and Bcl-xl following exogenous p53 expression has been reported previously in colorectal cancer cells (59). Following localization to the mitochondrial membrane under the influence of an apoptotic signal, Bax can induce mitochondrial-mediated apoptosis, but heterodimerization with antiapoptotic members of the Bcl-2 family suppresses Bax-mediated apoptosis (18, 22, 60, 61). We hypothesized that the p53- and Bax-dependent apoptotic response to oxaliplatin might be suppressed by concurrent expression of Bcl-xl.

To test this hypothesis, we used a second-generation chemically modified antisense oligonucleotide to profoundly down-regulate Bcl-xl expression in adherent viable cells in a dose-dependent and sequence-specific manner. Prior antisense-mediated Bcl-xl knockdown markedly increased the oxaliplatin-induced apoptotic response of HCT116-wt as demonstrated by Annexin V assays—reflecting early apoptotic changes—and by PARP cleavage assays—reflecting caspase activation in late apoptosis (54). Similar results were obtained in p21/WAF1 null HCT116. In contrast, oxaliplatin-induced apoptosis was not significantly increased by prior Bcl-xl knockdown in p53 null cells and was attenuated in Bax null as compared with HCT116-wt or p21/WAF1 null cells.

The lack of effect of missense controls as well as the p53 and Bax dependence of antisense effects demonstrate that the observed increase in apoptosis was not due to nonspecific effects of the oligonucleotides, although such nonspecific effects have recently been described for the combination of chemotherapy with oligonucleotides in vivo (62). Therefore, we conclude that oxaliplatin-induced Bcl-xl expression contributes to the protection of HCT116-wt cells from p53- and Bax-mediated apoptosis during a prolonged oxaliplatin-induced growth arrest, in keeping with a model in which a critical determinant of mitochondrial-mediated apoptosis is the ratio between proapoptotic and antiapoptotic Bcl-2 family members rather than their absolute expression levels (18–21). However, our data also imply that at least one other p53-dependent signal cooperates with the increase in Bax/Bcl-xl ratio to drive apoptosis, because basal or drug-induced Bax protein levels were insufficient to induce apoptosis in p53 null cells, even when the Bax/Bcl-xl ratio had been increased ~10-fold by antisense-mediated Bcl-xl knockdown. The nature of this additional p53-dependent apoptotic signal remains to be determined, but candidates include other known chemotherapy-induced, p53-regulated effectors of apoptosis (10, 58), several of which share the propensity to heterodimerize with Bcl-xl (15). Such redundant p53-mediated mechanisms presumably also account for the residual degree of apoptosis we observed following Bcl-xl knockdown combined with oxaliplatin treatment in Bax null cells.

Finally, aside from qualitative shift in cell fate in HCT116-wt, from growth arrest to apoptosis, antisense Bcl-xl knockdown also produced a quantitative supraadditive increase in the global activity of oxaliplatin in assays of total surviving adherent cell numbers. If these effects can be reproduced in vivo, either using antisense technology or using small molecule Bcl-xl inhibitors currently under development (63, 64), they might represent a means of enhancing the chemotherapeutic effect of oxaliplatin in the significant number of colorectal cancer patients whose tumors retain wild-type p53 or Bax function. It has recently been conclusively shown that downstream determinants of apoptosis (specifically Bcl-2 in a murine transgenic lymphoma model) can profoundly influence response to therapy in vivo and that prolonged drug-induced growth arrest can result in prolonged disease stability while providing a residual pool of viable malignant cells from which late relapsing clones may ultimately emerge (65). Therefore, it is desirable to switch the chemotherapeutic response of malignant cells from growth arrest to apoptosis, and the combination of oxaliplatin and Bcl-xl antisense merits testing in models of colorectal cancer in vivo.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 4/11/03; revised 10/23/03; accepted 11/13/03.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Raymond E, Faivre S, Woynarowski JM, Chaney SG. Oxaliplatin: mechanism of action and antineoplastic activity. Semin Oncol, 1998;25:4–12.[Medline]
  2. Shirota Y, Stoehlmacher J, Brabender J, et al. ERCC1 and thymidylate synthase mRNA levels predict survival for colorectal cancer patients receiving combination oxaliplatin and fluorouracil chemotherapy. J Clin Oncol, 2001;19:4298–304.[Abstract/Free Full Text]
  3. Vaisman A, Lim SE, Patrick SM, et al. Effect of DNA polymerases and high mobility group protein 1 on the carrier ligand specificity for translesion synthesis past platinum-DNA adducts. Biochemistry, 1999;38:11026–39.[CrossRef][Medline]
  4. Vaisman A, Varchenko M, Umar A, et al. The role of hMLH1, hMSH3, and hMSH6 defects in cisplatin and oxaliplatin resistance: correlation with replicative bypass of platinum-DNA adducts. Cancer Res, 1998;58:3579–85.[Abstract/Free Full Text]
  5. Fink D, Nebel S, Aebi S, et al. The role of DNA mismatch repair in platinum drug resistance. Cancer Res, 1996;56:4881–6.[Abstract/Free Full Text]
  6. Costanzo A, Merlo P, Pediconi N, et al. DNA damage-dependent acetylation of p73 dictates the selective activation of apoptotic target genes. Mol Cell, 2002;9:175–86.[CrossRef][Medline]
  7. Gong JG, Costanzo A, Yang HQ, et al. The tyrosine kinase c-Abl regulates p73 in apoptotic response to cisplatin-induced DNA damage. Nature, 1999;399:806–9.[CrossRef][Medline]
  8. Lin X, Ramamurthi K, Mishima M, Kondo A, Christen RD, Howell SB. P53 modulates the effect of loss of DNA mismatch repair on the sensitivity of human colon cancer cells to the cytotoxic and mutagenic effects of cisplatin. Cancer Res, 2001;61:1508–16.[Abstract/Free Full Text]
  9. Bunz F, Hwang PM, Torrance C, et al. Disruption of p53 in human cancer cells alters the responses to therapeutic agents. J Clin Invest, 1999;104:263–9.[Medline]
  10. el-Deiry WS. Regulation of p53 downstream genes. Semin Cancer Biol, 1998;8:345–57.[CrossRef][Medline]
  11. Gupta M, Fan S, Zhan Q, Kohn KW, O'Connor PM, Pommier Y. Inactivation of p53 increases the cytotoxicity of camptothecin in human colon HCT116 and breast MCF-7 cancer cells. Clin Cancer Res, 1997;3:1653–60.[Abstract]
  12. te Poele RH, Joel SP. Schedule-dependent cytotoxicity of SN-38 in p53 wild-type and mutant colon adenocarcinoma cell lines. Br J Cancer, 1999;81:1285–93.[CrossRef][Medline]
  13. Chan TA, Hermeking H, Lengauer C, Kinzler KW, Vogelstein B. 14-3-3{sigma} is required to prevent mitotic catastrophe after DNA damage. Nature, 1999;401:616–20.[CrossRef][Medline]
  14. Chan TA, Hwang PM, Hermeking H, Kinzler KW, Vogelstein B. Cooperative effects of genes controlling the G(2)/M checkpoint. Genes Dev, 2000;14:1584–8.[Abstract/Free Full Text]
  15. Yu J, Zhang L, Hwang PM, Kinzler KW, Vogelstein B. PUMA induces the rapid apoptosis of colorectal cancer cells. Mol Cell, 2001;7:673–82.[CrossRef][Medline]
  16. Lutz RJ. Role of the BH3 (Bcl-2 homology 3) domain in the regulation of apoptosis and Bcl-2-related proteins. Biochem Soc Trans, 2000;28:51–6.[Medline]
  17. Zha J, Harada H, Osipov K, Jockel J, Waksman G, Korsmeyer SJ. BH3 domain of BAD is required for heterodimerization with BCL-XL and pro-apoptotic activity. J Biol Chem, 1997;272:24101–4.[Abstract/Free Full Text]
  18. Yin XM, Oltvai ZN, Korsmeyer SJ. BH1 and BH2 domains of Bcl-2 are required for inhibition of apoptosis and heterodimerization with Bax. Nature, 1994;369:321–3.[CrossRef][Medline]
  19. Reed JC. Mechanisms of Bcl-2 family protein function and dysfunction in health and disease. Behring Inst Mitt, 1996;72–100.
  20. Chao DT, Korsmeyer SJ. BCL-2 family: regulators of cell death. Annu Rev Immunol, 1998;16:395–419.[CrossRef][Medline]
  21. Korsmeyer SJ. BCL-2 gene family and the regulation of programmed cell death. Cancer Res, 1999;59:1693s–1700s.
  22. Zhang L, Yu J, Park BH, Kinzler KW, Vogelstein B. Role of BAX in the apoptotic response to anticancer agents. Science, 2000;290:989–92.[Abstract/Free Full Text]
  23. Gourdier I, Del Rio M, Crabbe L, et al. Drug specific resistance to oxaliplatin is associated with apoptosis defect in a cellular model of colon carcinoma. FEBS Lett, 2002;529:232–6.[CrossRef][Medline]
  24. Chipuk JE, Bhat M, Hsing AY, Ma J, Danielpour D. Bcl-xL blocks transforming growth factor-ß 1-induced apoptosis by inhibiting cytochrome c release and not by directly antagonizing Apaf-1-dependent caspase activation in prostate epithelial cells. J Biol Chem, 2001;276:26614–21.[Abstract/Free Full Text]
  25. Crescenzi E, Criniti V, Pianese M, Tecce MF, Palumbo G. Differential expression of antiapoptotic genes in human endometrial carcinoma: bcl-XL succeeds bcl-2 function in neoplastic cells. Gynecol Oncol, 2000;77:419–28.[CrossRef][Medline]
  26. Fernandez Y, Espana L, Manas S, Fabra A, Sierra A. Bcl-xL promotes metastasis of breast cancer cells by induction of cytokines resistance. Cell Death Differ, 2000;7:350–9.[CrossRef][Medline]
  27. Hinz S, Trauzold A, Boenicke L, et al. Bcl-XL protects pancreatic adenocarcinoma cells against CD95- and TRAIL-receptor-mediated apoptosis. Oncogene, 2000;19:5477–86.[CrossRef][Medline]
  28. Walczak H, Bouchon A, Stahl H, Krammer PH. Tumor necrosis factor-related apoptosis-inducing ligand retains its apoptosis-inducing capacity on Bcl-2- or Bcl-xL-overexpressing chemotherapy-resistant tumor cells. Cancer Res, 2000;60:3051–7.[Abstract/Free Full Text]
  29. Cherbonnel-Lasserre C, Gauny S, Kronenberg A. Suppression of apoptosis by Bcl-2 or Bcl-xL promotes susceptibility to mutagenesis. Oncogene, 1996;13:1489–97.[Medline]
  30. Schott AF, Apel IJ, Nunez G, Clarke MF. Bcl-XL protects cancer cells from p53-mediated apoptosis. Oncogene, 1995;11:1389–94.[Medline]
  31. Amundson SA, Myers TG, Scudiero D, Kitada S, Reed JC, Fornace AJ Jr. An informatics approach identifying markers of chemosensitivity in human cancer cell lines. Cancer Res, 2000;60:6101–10.[Abstract/Free Full Text]
  32. Flohil CC, Janssen PA, Bosman FT. Expression of Bcl-2 protein in hyperplastic polyps, adenomas, and carcinomas of the colon. J Pathol, 1996;178:393–7.[CrossRef][Medline]
  33. Bosari S, Moneghini L, Graziani D, et al. bcl-2 oncoprotein in colorectal hyperplastic polyps, adenomas, and adenocarcinomas. Hum Pathol, 1995;26:534–40.[CrossRef][Medline]
  34. Yao T, Kajiwara M, Kouzuki T, Iwashita A, Tsuneyoshi M. Villous tumor of the colon and rectum with special reference to roles of p53 and bcl-2 in adenoma-carcinoma sequence. Pathol Int, 1999;49:374–82.[CrossRef][Medline]
  35. Krajewska M, Moss SF, Krajewski S, Song K, Holt PR, Reed JC. Elevated expression of Bcl-X and reduced Bak in primary colorectal adenocarcinomas. Cancer Res, 1996;56:2422–7.[Abstract/Free Full Text]
  36. Maurer CA, Friess H, Buhler SS, et al. Apoptosis inhibiting factor Bcl-xL might be the crucial member of the Bcl-2 gene family in colorectal cancer. Dig Dis Sci, 1998;43:2641–8.[CrossRef][Medline]
  37. Hirose Y, Yoshimi N, Suzui M, Kawabata K, Tanaka T, Mori H. Expression of bcl-2, bax, and bcl-XL proteins in azoxymethane-induced rat colonic adenocarcinomas. Mol Carcinog, 1997;19:25–30.[CrossRef][Medline]
  38. Saleh HA, Jackson H, Banerjee M. Immunohistochemical expression of bcl-2 and p53 oncoproteins: correlation with Ki67 proliferation index and prognostic histopathologic parameters in colorectal neoplasia. Appl Immunohistochem Mol Morphol, 2000;8:175–82.[CrossRef][Medline]
  39. Sinicrope FA, Hart J, Michelassi F, Lee JJ. Prognostic value of bcl-2 oncoprotein expression in stage II colon carcinoma. Clin Cancer Res, 1995;1:1103–10.[Abstract]
  40. Nita ME, Ono-Nita SK, Tsuno N, et al. Bcl-X (L) antisense sensitizes human colon cancer cell line to 5-fluorouracil. Jpn J Cancer Res, 2000;91:825–32.[CrossRef][Medline]
  41. Strasberg Rieber M, Zangemeister-Wittke U, Rieber M. p53-independent induction of apoptosis in human melanoma cells by a bcl-2/bcl-xL bispecific antisense oligonucleotide. Clin Cancer Res, 2001;7:1446–51.[Abstract/Free Full Text]
  42. Zangemeister-Wittke U, Leech SH, Olie RA, et al. A novel bispecific antisense oligonucleotide inhibiting both bcl-2 and bcl-xL expression efficiently induces apoptosis in tumor cells. Clin Cancer Res, 2000;6:2547–55.[Abstract/Free Full Text]
  43. Miyake H, Monia BP, Gleave ME. Inhibition of progression to androgen-independence by combined adjuvant treatment with antisense BCL-XL and antisense Bcl-2 oligonucleotides plus taxol after castration in the Shionogi tumor model. Int J Cancer, 2000;86:855–62.[CrossRef][Medline]
  44. Gautschi O, Tschopp S, Olie RA, et al. Activity of a novel bcl-2/bcl-xL-bispecific antisense oligonucleotide against tumors of diverse histologic origins. J Natl Cancer Inst, 2001;93:463–71.[Abstract/Free Full Text]
  45. Fennell DA, Corbo MV, Dean NM, Monia BP, Cotter FE. In vivo suppression of Bcl-XL expression facilitates chemotherapy-induced leukemia cell death in a SCID/NOD-Hu model. Br J Haematol, 2001;112:706–13.[CrossRef][Medline]
  46. Lebedeva I, Rando R, Ojwang J, Cossum P, Stein CA. Bcl-xL in prostate cancer cells: effects of overexpression and down-regulation on chemosensitivity. Cancer Res, 2000;60:6052–60.[Abstract/Free Full Text]
  47. Cotter FE, Waters J, Cunningham D. Human Bcl-2 antisense therapy for lymphomas. Biochim Biophys Acta, 1999;1489:97–106.[Medline]
  48. Waters JS, Webb A, Cunningham D, et al. Phase I clinical and pharmacokinetic study of bcl-2 antisense oligonucleotide therapy in patients with non-Hodgkin's lymphoma. J Clin Oncol, 2000;18:1812–23.[Abstract/Free Full Text]
  49. Jansen B, Wacheck V, Heere-Ress E, et al. Chemosensitization of malignant melanoma by BCL2 antisense therapy. Lancet, 2000;356:1728–33.[CrossRef][Medline]
  50. Sturm I, Kohne CH, Wolff G, et al. Analysis of the p53/BAX pathway in colorectal cancer: low BAX is a negative prognostic factor in patients with resected liver metastases. J Clin Oncol, 1999;17:1364–74.[Abstract/Free Full Text]
  51. Schelwies K, Sturm I, Grabowski P, et al. Analysis of p53/BAX in primary colorectal carcinoma: low BAX protein expression is a negative prognostic factor in UICC stage III tumors. Int J Cancer, 2002;99:589–96.[CrossRef][Medline]
  52. Bunz F, Dutriaux A, Lengauer C, et al. Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science, 1998;282:1497–501.[Abstract/Free Full Text]
  53. Steel GG. Peckham MJ. Exploitable mechanisms in combined radiotherapy-chemotherapy: the concept of additivity. Int J Radiat Oncol Biol Phys, 1979;5:85–91.[Medline]
  54. Whitacre CM, Zborowska E, Willson JK, Berger NA. Detection of poly (ADP-ribose) polymerase cleavage in response to treatment with topoisomerase I inhibitors: a potential surrogate end point to assess treatment effectiveness. Clin Cancer Res, 1999;5:665–72.[Abstract/Free Full Text]
  55. Gayet J, Zhou XP, Duval A, et al. Extensive characterization of genetic alterations in a series of human colorectal cancer cell lines. Oncogene, 2001;20:5025–32.[CrossRef][Medline]
  56. Kern W, Braess J, Bottger B, Kaufmann CC, Hiddemann W, Schleyer E. Oxaliplatin pharmacokinetics during a four-hour infusion. Clin Cancer Res, 1999;5:761–5.[Abstract/Free Full Text]
  57. Graham MA, Lockwood GF, Greenslade D, Brienza S, Bayssas M, Gamelin E. Clinical pharmacokinetics of oxaliplatin: a critical review. Clin Cancer Res, 2000;6:1205–18.[Abstract/Free Full Text]
  58. Yu J, Zhang L, Hwang PM, Rago C, Kinzler KW, Vogelstein B. Identification and classification of p53-regulated genes. Proc Natl Acad Sci USA, 1999;96:14517–22.[Abstract/Free Full Text]
  59. Merchant AK, Loney TL, Maybaum J. Expression of wild-type p53 stimulates an increase in both Bax and Bcl-xL protein content in HT29 cells. Oncogene, 1996;13:2631–7.[Medline]
  60. Yin C, Knudson CM, Korsmeyer SJ, Van Dyke T. Bax suppresses tumorigenesis and stimulates apoptosis in vivo. Nature, 1997;385:637–40.[CrossRef][Medline]
  61. Ionov Y, Yamamoto H, Krajewski S, Reed JC, Perucho M. Mutational inactivation of the proapoptotic gene BAX confers selective advantage during tumor clonal evolution. Proc Natl Acad Sci USA, 2000;97:10872–7.[Abstract/Free Full Text]
  62. Agrawal S, Kandimalla ER, Yu D, et al. Potentiation of antitumor activity of irinotecan by chemically modified oligonucleotides. Int J Oncol, 2001;18:1061–9.[Medline]
  63. Degterev A, Lugovskoy A, Cardone M, et al. Identification of small-molecule inhibitors of interaction between the BH3 domain and Bcl-xL. Nat Cell Biol, 2001;3:173–82.[CrossRef][Medline]
  64. Tzung SP, Kim KM, Basanez G, et al. Antimycin A mimics a cell-death-inducing Bcl-2 homology domain 3. Nat Cell Biol, 2001;3:183–91.[CrossRef][Medline]
  65. Schmitt CA, Fridman JS, Yang M, et al. A senescence program controlled by p53 and p16INK4a contributes to the outcome of cancer therapy. Cell, 2002;109:335–46.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
T. Hata, H. Yamamoto, C. Y. Ngan, M. Koi, A. Takagi, B. Damdinsuren, M. Yasui, Y. Fujie, T. Matsuzaki, H. Hemmi, et al.
Role of p21waf1/cip1 in effects of oxaliplatin in colorectal cancer cells
Mol. Cancer Ther., October 1, 2005; 4(10): 1585 - 1594.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
T. Wada, J. W. Pippin, C. B. Marshall, S. V. Griffin, and S. J. Shankland
Dexamethasone Prevents Podocyte Apoptosis Induced by Puromycin Aminonucleoside: Role of p53 and Bcl-2-Related Family Proteins
J. Am. Soc. Nephrol., September 1, 2005; 16(9): 2615 - 2625.
[Abstract] [Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
Y. Fujie, H. Yamamoto, C. Y. Ngan, A. Takagi, T. Hayashi, R. Suzuki, K. Ezumi, I. Takemasa, M. Ikeda, M. Sekimoto, et al.
Oxaliplatin, a Potent Inhibitor of Survivin, Enhances Paclitaxel-induced Apoptosis and Mitotic Catastrophe in Colon Cancer Cells
Jpn. J. Clin. Oncol., August 1, 2005; 35(8): 453 - 463.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hayward, R. L.
Right arrow Articles by Jodrell, D. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hayward, R. L.
Right arrow Articles by Jodrell, D. I.


HOME