| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of 1 Molecular and Cellular Oncology, 2 Applied Genomics, and 3 Cancer Pharmacology, Millennium Pharmaceuticals, Inc., Cambridge, MA; 4 Xenova, Ltd., Slough, United Kingdom; and Departments of 5 Biochemistry and 6 Medicine, Vanderbilt University School of Medicine, Nashville, TN
Requests for Reprints: Darshan S. Sappal, Millennium Pharmaceuticals, Inc., 40 Landsdowne Street, Cambridge, MA 02140. Phone: (617) 551-3921; Fax: (617) 551-2902. E-mail: darshan.sappal{at}mpi.com
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
|
Additional studies demonstrated that the cellular cytotoxic potency of MLN944 was unaffected by down-regulation of topoisomerase II or the presence of a point mutation in topoisomerase I (1). The proposed mechanism of topoisomerase poisoning was based on the observation that MLN944 stabilized topoisomerase-dependent cleavage complexes using linear plasmid DNA and purified topoisomerases I and II. However, the relatively modest increases in enzyme-mediated DNA cleavage were observed at high concentrations of MLN944 relative to its potent cellular cytotoxic activity (1). Furthermore, the effects were marginal in comparison to standard topoisomerase poisons, etoposide and camptothecin. Taken together, these data suggest that the potency and primary mechanism of action of MLN944 in cells could not be explained simply by topoisomerase inhibition.
As a first step toward further understanding the mechanism of action of MLN944, the current studies investigated the ability of MLN944 to directly alter the function of DNA topoisomerases and explored possibilities of other potential mechanisms of action. Using enzymology, yeast model systems, cell cycle analysis, and transcriptional profiling, the results described herein establish that while the mechanism of action of MLN944 involves DNA binding, the primary mechanism of action does not appear to involve DNA topoisomerase inhibition.
| Materials and Methods |
|---|
|
|
|---|
Topoisomerases I and II Catalyzed DNA Strand Passage
DNA strand passage activity assays were conducted as described previously and were based on the ability of the enzymes to negatively supercoil relaxed DNA in the presence of intercalating agents (9). Topoisomerase I DNA strand passage assays contained 5 nM relaxed pBR322 plasmid DNA and calf thymus topoisomerase I (9 units) in 20 µl of relaxation buffer. Reactions were carried out in the absence of drug or in the presence of 2 µM MLN944 or 10 µM ethidium bromide. All reaction mixtures contained 1% DMSO (final concentration). Reactions were incubated for up to 15 min at 37°C, then stopped, processed, and subjected to gel electrophoresis as above. For topoisomerase II strand passage assays, reaction mixtures contained 5 nM relaxed pBR322 plasmid DNA, 225 nM human topoisomerase II
, and 2 µM of MLN944 in 20 µl of relaxation buffer that contained 1 mM ATP. Human topoisomerase II
was expressed in Saccharomyces cerevisiae (10) and purified as described previously (11, 12). Samples were incubated for up to 15 min at 37°C. Reactions were stopped, processed, and subjected to gel electrophoresis as described for topoisomerase I DNA unwinding assays.
Topoisomerase I DNA Cleavage Assays
Topoisomerase I DNA cleavage reactions contained calf thymus topoisomerase I (14 units), 5 nM negatively supercoiled pBR322 DNA, and 01 µM MLN944 (or 25 µM camptothecin) in a total of 20 µl of topoisomerase I cleavage buffer [50 mM Tris-HCl (pH 7.5), 50 mM KCl, 10 mM MgCl2, 0.5 mM DTT, 0.1 mM EDTA, and 30 µg/ml BSA]. Reactions were started by the addition of drug and incubated for 6 min at 37°C to allow the cleavage/religation reaction of the enzyme to reach equilibrium. Cleavage intermediates were trapped by adding 2 µl of 1% SDS, followed by 1 µl of 375 mM NaEDTA (pH 8.0). Proteinase K was added (2 µl of 0.8 mg/ml) and reactions were incubated 30 min at 45°C to digest the topoisomerase I. Samples were mixed with 2 µl of agarose gel loading buffer [30% sucrose in 10 mM Tris-HCl (pH 7.9)], heated at 45°C for 2 min, and subjected to electrophoresis in a 1% agarose gel in TBE buffer containing 0.5 µg/ml ethidium bromide. Cleavage was monitored by the conversion of negatively supercoiled plasmid to nicked DNA. DNA bands were visualized by UV light and quantified as described above.
Topoisomerase II
DNA Cleavage Assays
Topoisomerase II DNA cleavage reactions were carried out as described previously (13). Assays contained 225 nM human topoisomerase II
, 5 nM negatively supercoiled pBR322 DNA, 1 mM ATP, and 05 µM MLN944 (or 050 µM etoposide) in a total of 20 µl of topoisomerase II cleavage buffer [10 mM Tris-HCl, (pH 7.9), 50 mM KCl, 5 mM MgCl2, 0.1 mM NaEDTA, and 2.5% glycerol]. Reactions were started by the addition of drug and incubated for 6 min at 37°C to establish DNA cleavage/religation equilibria. Cleavage intermediates were trapped by adding 2 µl of 5% SDS followed by 1 µl of 375 mM NaEDTA, pH 8.0, and proteinase K treatment was carried out as above. Samples were mixed with 2 µl of agarose gel loading buffer, heated at 45°C for 2 min, and subjected to electrophoresis in a 1% agarose gel in TAE buffer [40 mM Tris-acetate (pH 8.3), 2 mM EDTA] containing 0.5 µg/ml ethidium bromide. Cleavage was monitored by the conversion of negatively supercoiled DNA to linear molecules. Visualization and quantitation of DNA bands were as described above.
Yeast Strains and Media
S. cerevisiae cells were grown in either YPD or SD medium (14). The latter was supplemented with uracil and leucine (85.6 and 173.4 mg/l final concentration, respectively) as required by the strain. The TOP2 and top2-1 strains were described previously (15). All other strains are diploid and are congenic with BY4743 (16). Because wild-type yeast are relatively insensitive to topoisomerase poisons (15), we employed strains defective for one or more drug efflux pumps. The top1 pdr5 snq2 strain was constructed using standard methods (14). The
pdr5::HIS3 and
snq2::HIS3 mutations are derived from MMB1489 (17). Null alleles of pdr5 were created by PCR amplification (primers 5' CGACGTTACTAGCTACTCCTCC 3' and 5' ACATTAGCTAAGTAATCATTGG 3') of genomic DNA from MMB1489 and subsequent transformation into the appropriate strains. The genotypes of the strains were verified by testing for sensitivity to known substrates specific for each drug pump (18).
Yeast Drug Susceptibility Assays
Yeast strains were treated with 2-fold serial dilutions of the indicated drugs in 96-well microtiter plates. MLN944 was stored as a 20 mg/ml solution in 5% dextrose; camptothecin and etoposide were stored as a 5 and 10 mg/ml solution, respectively, in DMSO. For the experiments using the top1 mutant, SD medium was used. The starting inoculum was 3 x 105 cells/well. Following incubation for 48 h at 30°C, growth was determined by measuring A600 nm using a SpectraMax250 (Amersham, Piscataway, NJ). This protocol was used for the experiments using the top2 mutants with the exception that YPD medium was used and inoculated with 6 x 103 cells/well. The drug susceptibility assay was performed 4 times, each time with varying drug concentrations. Independently, zone of inhibition assays on agar-containing medium were also performed using the top1 and top2 mutants. All of these experiments yielded similar results.
Cell Lines
The human colon cancer cell line, HCT116, was obtained from the American Type Culture Collection (Manassas, VA) and maintained in McCoys 5A (Life Technologies, Inc., Grand Island, NY) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT) and 1% L-glutamine (Invitrogen). The human small cell lung cancer cell line, H69, also from ATCC, was maintained in RPMI 1640 supplemented with 10% fetal bovine serum (Hyclone) and 1% L-glutamine (Invitrogen). All cell lines were cultured in 5% CO2 and 95% humidified air atmosphere at 37°C.
Cell Cycle and FACS Analysis
For all cell cycle studies, MLN944 was dissolved in DMSO at a stock solution of 5 mM and stored at 20°C. The following stock solutions were used for cell cycle analysis: 250 mM stock of mimosine (Sigma) in 1 M potassium hydroxide and a 5 mg/ml stock of nocodazole (Sigma) in DMSO.
For fluorescence-activated cell sorting (FACS) analysis, control and treated cells were typsinized, harvested, and washed briefly in 1x PBS and subsequently fixed in 70% ethanol for approximately 16 h. After fixation, DNA staining was performed by incubating cells in PBS solution containing propidium iodide (Sigma) at 50 µg/ml and RNase A (Qiagen Sciences) at 5 µg/ml for a minimum of 1 h at room temperature. DNA content was used to distinguish each cell cycle phase using flow cytometry. Flow cytometry was measured using FACScalibur (Becton Dickinson, Franklin Lakes, NJ) and analyzed using Winlist and Modfit (Verity Software, Topsham, ME).
For single synchronization studies, HCT116 cells were plated overnight in a six-well dish at a density of 5 x 105 cells/well. Cells were treated for approximately 16 h with 0.5 mM mimosine or 0.1 µg/ml nocodazole to induce cell cycle arrests. Cells were then washed with PBS before treatment with EC50 (0.3 nM) or EC80 (20 nM) of MLN944, EC50 (50 nM) of camptothecin or EC50 (200 nM) of doxorubicin, for various time points before harvesting cells for cell cycle analysis. EC50 and EC80 concentrations were generated using the cell proliferation reagent WST-1 (Roche Applied Sciences, Indianapolis, IN) assay before synchronization experiments.
For double synchronization studies, HCT116 cells were plated overnight in a six-well dish at a density of 2.5 x 105 cells/well. Cells were initially treated for approximately 16 h with 0.5 mM mimosine to arrest cells in G1. Cells were then washed once in PBS, and either subjected to a 48-h treatment at the EC80 (20 nM) concentration of MLN944 or media alone. At 48 h posttreatment, cells underwent another brief PBS wash following an additional 16 h treatment of either media alone, 0.5 mM mimosine, or 0.1 µg/ml nocodazole. Cells were then harvested for cell cycle analysis as described above.
| Xenograft Studies |
|---|
|
|
|---|
RNA Processing and DNA Array
Tumor samples for microarray analysis were obtained by dosing animals with MLN944 or CPT-11 twice a week for a total of 3 weeks. Mice were weighed and tumor volumes were estimated with caliper measurements twice a week throughout the treatment period. Tissue samples were thoroughly homogenized in RNA-STAT-60 (Tel-Test, Friendswood, TX) and RNA extracted as per the manufacturer's protocol. Samples were treated individually and not pooled. Ten micrograms of total RNA were used to make the cDNA preparation. Double-stranded cDNA was prepared using the SuperScript II RT kit (Invitrogen) according to Affymetrix Eukaryotic Target Preparation protocol. Biotinylated cRNA was prepared using the BioArray High Yield RNA Transcript Labeling kit (ENZO). After in vitro transcription, the unincorporated nucleotides were removed using RNeasy columns (Qiagen). Then, 10 µg of the biotinylated cRNA per chip were fragmented at 95°C for 35 min in Fragmentation Buffer containing 40 mM Tris-acetate (pH 8.1), 100 mM potassium acetate, and 30 mM magnesium acetate. The fragmented cRNA was heated at 95°C for 5 min and subsequently at 45°C for 5 min then hybridized to the U133A GeneChip (Affymetrix, Santa Clara, CA) for 1618 h at 45°C with constant rotation (60 rpm). After hybridization, the DNA microarrays were washed and stained on Affymetrix Fluidics Stations according to the protocol provided by Affymetrix. The DNA microarrays were scanned and their images analyzed by Microarray Suite Expression Analysis Software (MASv5, Affymetrix). The data were processed using GeneMath software.
| Results |
|---|
|
|
|---|
Because intercalative drugs locally unwind DNA, they induce compensatory unconstrained positive superhelical twists in distal regions of covalently closed circular DNA (19). Therefore, in the presence of an intercalative compound, a plasmid that is relaxed (i.e., contains no superhelical twists) becomes positively supercoiled. Treatment of drug-DNA complexes with mammalian topoisomerase I removes the unconstrained positive DNA superhelical twists that result from drug intercalation (20). Following this treatment, extraction of the compound allows the constrained local drug-induced unwinding to redistribute in a global manner and manifest itself as a net negative supercoiling of the plasmid. Thus, in the presence of an intercalative agent such as ethidium bromide, topoisomerase I treatment converts relaxed plasmids to negatively supercoiled molecules (Fig. 2). Conversely, when a nonintercalative drug such as etoposide is included in reaction mixtures, no DNA supercoiling is observed following treatment with the type I enzyme.
|
MLN944 Does Not Inhibit the Catalytic Activity of Topoisomerase I or Topoisomerase II
Experiments were performed to determine whether MLN944 interferes with the catalytic DNA strand passage activity of calf thymus topoisomerase I or human topoisomerase II
. Because MLN944 intercalates into DNA, its effects on enzyme-catalyzed DNA strand passage were assessed by a DNA supercoiling assay. The rate at which relaxed plasmid was converted to negatively supercoiled molecules in the presence of MLN944 was compared to enzyme-catalyzed reactions carried out in the presence of ethidium bromide. Previously, it was shown that ethidium bromide has little effect on the overall rate of DNA strand passage catalyzed by topoisomerase I or II (21).
Reactions were carried out in the presence of either 2 µM MLN944 or 10 µM ethidium bromide (the concentration of each that was required to fully unwind the plasmid, see Fig. 2). As seen in Fig. 3, rates of DNA supercoiling catalyzed by topoisomerase I (Fig. 3A) or topoisomerase II
(Fig. 3B) in the presence of MLN944 were at least as fast as those observed in the presence of ethidium bromide. These results indicate that in the active range of MLN944 (2 µM; see Fig. 2), the drug does not significantly inhibit the overall catalytic activity of either topoisomerase I or topoisomerase II.
|
in Vitro
was examined (Fig. 4). Because type I topoisomerases catalyze topological changes in duplex DNA by reversibly nicking one strand, and type II enzymes cut both strands of the double helix, DNA cleavage was assessed by the ability to convert negatively supercoiled plasmid into nicked or linear molecules, respectively.
|
, Fig. 4B) were marginal. Furthermore, levels of DNA scission dropped for both enzymes when the concentration of MLN944 increased above 0.5 µM, which may be the result of MLN944 intercalation. These findings predict that the cytotoxic properties of MLN944 are unrelated to its effects on DNA scission mediated by either topoisomerase I or II.
Topoisomerases I and II Are Not the Cellular Targets of MLN944 in S. cerevisiae
To further evaluate the possible role of topoisomerases I and/II in the observed MLN944 cellular cytotoxicity, we assessed the activity of MLN944 in the yeast S. cerevisiae. Previous studies have shown that mutants lacking the type I topoisomerase, designated top1
, are resistant to type I poisons (22). We compared the effects of camptothecin and MLN944 on the growth of top1
mutants. As shown in Fig. 5, the top1
mutants were highly resistant to camptothecin (Fig. 5A), as expected. In contrast, deletion of TOP1 had no effect on the sensitivity of cells to MLN944 (Fig. 5B). A similar experiment was performed to determine whether MLN944 acts as a type II topoisomerase poison (15). The type II topoisomerase is encoded by TOP2. Because this gene is required for viability in yeast, a partial-loss-of-function mutation, top2-1, was used. The activity of the mutant protein is temperature dependent: at 30°C, top2-1 cells contain only 15% of wild-type topoisomerase II activity. As expected, the known topoisomerase II poison etoposide showed decreased activity against the top2-1 strain (Fig. 6A), while the activity of MLN944 was similar in both strains (Fig. 6B) at 30°C. The results of these studies indicate that in S. cerevisiae, MLN944 acts via a mechanism independent of topoisomerase poisoning.
|
|
HCT116 cells grown asynchronously exhibited a typical cell cycle profile (Fig. 7A). To obtain a more homogenous response to MLN944 treatment, we carried out experiments using synchronized HCT116 cells. As shown previously (26), following treatment of asynchronous cells with either mimosine or nocodazole causes 7080% of the HCT116 cells to undergo a G1 or G2-M arrest, respectively (Fig. 7A). To assess the effect of MLN944 on the cell cycle, HCT116 cells were synchronized in either G1 or G2-M phase of the cycle, washed, and subsequently incubated in the continued absence or presence of MLN944 for up to 48 h (Fig. 7).
|
To differentiate whether the accumulation of MLN944 cells in G1 and G2-M resulted from a permanent or transient event, cells were first synchronized in G1, grown in the presence or absence of MLN944 for 48 h as in Fig. 7B, washed, and re-blocked for 16 h with either mimosine or nocodazole (Fig. 7C). The second dose of blocking agents did not provoke any noticeable effects in the control cells (i.e., high percentage of cell death, data not shown). The control cells were also fully capable of once again becoming arrested in G1 or G2-M (Fig. 7C). Conversely, the MLN944-treated cells were permanently arrested in G1 and G2-M after the first 48 h dose of the compound as addition of G1 or G2-M blocking agents to these arrested cells had no impact on the cell cycle profile (Fig. 7C). Collectively, these data show that treatment with MLN944 permanently arrests cells in G1 as well as G2-M and further implies that the effect of MLN944 on the cell cycle is distinct from those of topoisomerase I and II poisons.
Clustering of Gene Expression Patterns Differentiate MLN944 from CPT-11 in a Xenograft Tumor Model
The in vivo activity of MLN944 has been examined previously in both the H69 SCLC and HT29 colon carcinoma xenografts in nude mice (1). In that study, MLN944 induced tumor regression at 10 and 15 mg/kg (every 4 days for 3 weeks or q4dx3) while topotecan (20 mg/kg: q4dx3) or etoposide (30 mg/kg: every 5 days for 3 weeks or q5dx3) caused tumor stasis for approximately 10 days before regrowth of the tumor. Therefore, in an attempt to differentiate the response of tumors treated with a topoisomerase poison or MLN944 at the molecular level, we examined compound-treated xenograft tumors using DNA microarray analysis.
Figure 8 shows the estimated mean tumor volume plotted as a function of time. Similar to previously published data (1), at the low dose of 5 mg/kg MLN944, administered twice weekly via tail vein injection, tumor growth was inhibited by 97.2% over the treatment period of 3 weeks compared with the vehicle control group. The estimated mean tumor volume of the treated group was 57.0 ± 9.3 mm3 compared with the control vehicle group, 2132.9 ± 395.0 mm3, and was considered significant tumor regression (P < 0.001) using the ANOVA test. Increasing the dose to 15 mg/kg MLN944 at the same regime caused greater tumor regression (98.8%; P < 0.001), with the final estimated mean tumor volume of 25.2 ± 6.7 mm3. CPT-11, dosed at the maximum tolerated dose of 45 mg/kg, twice a week, also caused significant tumor regression (93.7%, P < 0.001), with the final estimated mean tumor volume of 134.1 ± 16.3 mm3. Comparing tumor responses after MLN944 or CPT-11 treatment indicates that in this model, MLN944 is superior to CPT-11 at causing regression of established xenograft tumors (compare MLN944: 25.2 ± 6.7 mm3 to CPT-11: 134.1 ± 16.3 mm3). In all cases, no observable drug-related toxicity was observed, as judged by serial body weight change (data not shown).
|
|
| Discussion |
|---|
|
|
|---|
Prior evidence suggesting MLN944 functioned as a dual topoisomerase I and II poison was based on two observations: (a) the ability of MLN944 to stabilize cleavable complexes with both enzymes, and (b) the ability of MLN944 to retain activity in mammalian cells with reduced topoisomerase I or II activity (1). However, although the DNA cleavage assay used in the previous study was very sensitive, the observed increases in enzyme-mediated DNA cleavage in the presence of MLN944 were marginal. In addition, the ability of MLN944 to retain activity in cells with reduced topoisomerase I or II activity could equally imply that neither topoisomerase is a substrate for MLN944, thus suggesting a novel mode of action for MLN944 distinct from topoisomerase inhibition.
We have confirmed that MLN944 binds (2) and intercalates into DNA and have demonstrated that MLN944 does not inhibit the catalytic activity of either topoisomerase I or II. Furthermore, the compound does not stimulate DNA cleavage mediated by these enzymes to any significant extent. The notion that MLN944 intercalates into DNA but does not act as a topoisomerase inhibitor is not novel because other compounds, including ethidium bromide, also have this characteristic. For example, a benzycycloheptaindol-6-one derivative has recently been designed that clearly behaves as a typical DNA intercalating agent but does not stimulate DNA cleavage by topoisomerases (30).
In S. cerevisiae, well-defined topoisomerase mutants have been used to develop cell-based assays to identify drugs that target this class of enzymes. Previous studies in yeast have shown that topoisomerase I is the sole target of camptothecin because the cytotoxic effects of camptothecin but not those of m-AMSA, a DNA topoisomerase II inhibitor, disappear if the gene encoding DNA topoisomerase I is disrupted (31, 32). Conversely, expression of wild-type DNA topoisomerase I restores camptothecin sensitivity (33). Similar yeast strains that harbor topoisomerase II mutations have shown that topoisomerase II is the primary cellular target of doxorubicin and other topoisomerase II poisons (15). Our results with such strains (see Figs. 5 and 6) indicate that the cytotoxicity of MLN944 is not dependent on the level or activity of either topoisomerase I or II.
In addition, the presented cell cycle experiments indicate that MLN944 treatment induces a non-reversible cell arrest in both the G1 and G2-M phases of the cell cycle. At this time, the authors have no knowledge of other compounds that are suggested to be a single or dual topoisomerase poison or inhibitor that induces cell cycle arrest in both the G1 and G2 phases of the cell cycle. However, in the hope of inducing fatal apoptotic mechanisms, many anticancer drugs, including cyclin-dependent kinase (CDK) small molecule inhibitors, recently have been developed that arrest cells at the G1 and/or G2-M phase of the cell cycle (reviewed in Refs. 34, 35). Regulation of CDKs as well as other cell cycle-related proteins is necessary for progression through the cell cycle. While it may be attractive to speculate that MLN944 could be directly targeting a cell cycle specific protein to induce the observed G1 and G2-M arrest, there is no current evidence to support the proposal of a protein substrate. Instead, our data and those of others (2) show that MLN944 clearly targets nucleic acids. Whether MLN944 is capable of interacting with proteins in addition to nucleic acids is currently under investigation.
Cell division inhibition is a universal response to DNA damage. In eukaryotes, DNA-damaging agents cause the arrest of cells in the G1 and G2-M phase of the cell cycle (27, 28). Presumably, the delay in cell division enables the cells to repair damaged DNA and/or complete DNA replication. The HCT116 cells are a MSH-2-deficient, non-apoptotic colon cancer-derived cell line that expresses functional p53 (36). These cells have been shown previously to arrest in G2-M phase after DNA damage induced by adriamycin or ionizing radiation (29). The observed G1 and G2-M cell cycle block induced by MLN944 in these cells was not dependent on p53 activity because a variety of both functional and non-functional p53 cell lines (HT29, SKOV3, HCT116, L23, H460) were treated with MLN944 and assayed by FACS analysis with similar results (data not shown). The presence of a G2-M arrest in HCT116 cells after treatment with MLN944 suggests that this compound could be inducing DNA damage, particularly because MLN944 is a strong intercalative compound. However, DNA intercalation is not a prerequisite to initiate a DNA damage response. F11782, a catalytic inhibitor of topoisomerases I and II, does not bind or interact with DNA, yet the compound is still capable of inducing DNA damage as well as imposing a G2-M cell cycle block (37, 38). Although these data suggest that the observed G2-M cell cycle block may be a cellular response to DNA damage induced by MLN944, further examination of this hypothesis is warranted.
A number of examples are available in the literature that examine the transcriptional events modified by the addition of topoisomerase poisons or other cytotoxic agents including camptothecin, etoposide, doxorubicin, methotrexate, cisplatin, and paclitaxel. Many of these studies include assessment of treated samples for a drug-resistant phenotype in cell lines (3941) while others assess pathways perturbed after compound treatment in cultured cells (42, 43) or clinical patient samples (44). We have extended these previous observations to include comparison of the in vivo molecular response of MLN944- and CPT-11-treated xenograft tumors.
Our data illustrate that a variety of genes, both characterized and uncharacterized, are differentially regulated on MLN944 or CPT-11 treatment. These data are in accordance with previously published array data exploring similar cytotoxic compounds. Close examination of regulated genes in the heat map reveals a subset of genes encoding members of the ubiquitin proteasome pathway that appear to be regulated differentially with MLN944 treatment compared to control and CPT-11-treated tumors (ubiquitin conjugating enzyme E2D 3, ubiquitin C, ubiquitin specific protease 10, and ubiquitin specific protease 15; see Fig. 9A). Interestingly, ubiquitin-dependent proteolysis has been shown to play an essential role in a number of cellular processes including signal transduction (45) and cell cycle progression by affecting the transition from G1 to S phase (reviewed in 46). A growing body of evidence also suggests that the ubiquitin-proteasome system is tightly interconnected with the transcription process (reviewed in 47). The increased expression of ubiquitin-proteasome pathway genes observed in the MLN944-treated xenografts and not in the CPT-11-treated tumors may suggest utilization of divergent pathways that lead ultimately to cell death and subsequent tumor regression in these animals. Such cascades of events, however, are only speculative at this time and merit further investigation.
In conclusion, the data presented here fully support the identification of MLN944 as a potent anticancer agent. Furthermore, the data strongly suggest that neither topoisomerase I nor topoisomerase II is the primary cellular target for this compound. Additional studies examining the primary effects of MLN944 on DNA, RNA, and protein synthesis are currently being explored.
| Acknowledgments |
|---|
| Footnotes |
|---|
Grant support: N.Osheroff is supported by NIH grant GM33944. A.K.McClendon is a trainee under National Institutes of Health Grant 5 T32 CA09582.
Note: Present address of P.Charlton: Vertex Pharmaceuticals, Ltd., Abingdon, Oxfordshire, United Kingdom. Present address of L.A. Rudolf-Owen: Eisai Research Institute, Andover, MA.
Received 8/27/03; revised 10/10/03; accepted 10/23/03.
| References |
|---|
|
|
|---|
by blocking DNA cleavage. J Biol Chem. 1998;27317643650.
and stimulate cleavage proximal to leukemic 11q23 chromosomal breakpoints. Biochemistry. 1997;36:59349.[CrossRef][Medline]
Osheroff N, Zechiedrich EL. Calcium-promoted DNA cleavage by eukaryotic topoisomerase II: trapping the covalent enzyme-DNA complex in an active form. Biochemistry. 1987;26:43039.[CrossRef][Medline]
Guthrie C, Fink GR. Methods in enzymology: guide to yeast genetics and molecular biology. New York, NY: Academic Press, Inc.; 1991.
Nitiss JL, Nitiss KC. Yeast systems for demonstrating the targets of anti-topoisomerase II agents. Methods Mol Biol. 2001;95:31527.[Medline]
Brachmann CB, Davies A, Cost GJ, Caputo E, Li J, Hieter P, et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 1998;14:11532.[CrossRef][Medline]
Wu L, Pan J, Thoroddsen V, Wysong DR, Blackman RK, Bulawa CE, et al. Novel small-molecule inhibitors of RNA polymerase III. Eukaryot Cell. 2003;2:25664.
is required to prevent mitotic catastrophe after DNA damage. Nature. 1999;401:61620.[CrossRef][Medline]
Benoit J, Routier S, Merour JY, Colson P, Houssier C, Bailly C. DNA but not topoisomerases is a target for a cytotoxic benzo[5,6]cyclohepta[b]indol-6-one derivative. Anticancer Res. 2000;20:330714.[Medline]
Nitiss J, Wang JC. DNA topoisomerase-targeting antitumor drugs can be studied in yeast. Proc Natl Acad Sci USA. 1988;85:75015.This article has been cited by other articles:
![]() |
C. Punchihewa, A. De Alba, N. Sidell, and D. Yang XR5944: A potent inhibitor of estrogen receptors Mol. Cancer Ther., January 1, 2007; 6(1): 213 - 219. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Luo, Q. He, X. He, Y. Hu, W. Lu, Y. Cheng, and B. Yang Potent antitumor activity of 10-methoxy-9-nitrocamptothecin. Mol. Cancer Ther., April 1, 2006; 5(4): 962 - 968. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kosakowska-Cholody, W. M. Cholody, A. Monks, B. A. Woynarowska, and C. J. Michejda WMC-79, a potent agent against colon cancers, induces apoptosis through a p53-dependent pathway Mol. Cancer Ther., October 1, 2005; 4(10): 1617 - 1627. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Byers, B. Schafer, D. S. Sappal, J. Brown, and D. H. Price The antiproliferative agent MLN944 preferentially inhibits transcription Mol. Cancer Ther., August 1, 2005; 4(8): 1260 - 1267. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Di Nicolantonio, L. A. Knight, P. A. Whitehouse, S. J. Mercer, S. Sharma, P. A. Charlton, D. Norris, and I. A. Cree The ex vivo characterization of XR5944 (MLN944) against a panel of human clinical tumor samples Mol. Cancer Ther., December 1, 2004; 3(12): 1631 - 1637. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dai, C. Punchihewa, P. Mistry, A. T. Ooi, and D. Yang Novel DNA Bis-intercalation by MLN944, a Potent Clinical Bisphenazine Anticancer Drug J. Biol. Chem., October 29, 2004; 279(44): 46096 - 46103. [Abstract] [Full Text] [PDF] |