Molecular Cancer Therapeutics CTRC-AACR San Antonio Breast Cancer Symposium
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hose, C. D.
Right arrow Articles by Monks, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hose, C. D.
Right arrow Articles by Monks, A.
Mol Cancer Ther. 2003;2:1265-1272
© 2003 American Association for Cancer Research

Induction of CYP1A1 in tumor cells by the antitumor agent 2-[4-amino-3-methylphenyl]-5-fluoro-benzothiazole: A potential surrogate marker for patient sensitivity

Curtis D. Hose1, Melinda Hollingshead2, Edward A. Sausville2 and Anne Monks1

1 SAIC-Frederick, National Cancer Institute-Frederick, Developmental Therapeutics Program, STB-Functional Genomics Laboratory, Frederick, MD, and 2 Developmental Therapeutics Program, National Cancer Institute, National Institutes of Health, Bethesda, MD

Requests for Reprints: Anne Monks, STB Laboratory of Functional Genomics, SAIC-Frederick Inc., Building 432/230, P. O. Box B, Frederick, MD 21702.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A candidate antitumor agent, 2-(4-amino-3-methylphenyl)-5-fluoro-benzothiazole (5F-203), like its non-fluorinated parent compound (DF-203), has a unique cytotoxicity pattern in the National Cancer Institute in vitro anticancer drug screen. These compounds show selective toxicity for a subset of cell types including estrogen receptor positive breast cancer and certain renal and ovarian cancer cell lines. Metabolic activation of these benzothiazoles seems to be mediated through the CYP1 family of cytochrome P450s. In an effort to characterize the involvement of CYP1A1 and CYP1B1 in the unique toxicity response of 5F-203, constitutive and 5F-203-induced gene expression patterns were measured in 60 cell lines of the National Cancer Institute drug screen using TaqMan real-time PCR. The patterns of CYP1A1 and CYP1B1 gene expression in the 60 cell lines were correlated with the toxicity pattern of 5F-203 and DF-203. There was significant correlation between drug sensitivity and induced CYP1A1 (R = 0.752, P < 0.001), but not constitutive CYP1A1 mRNA expression. CYP1A1 protein expression was found to mirror the corresponding gene expression, indicating that gene expression changes were concordant with function. Treatment of sensitive cell lines with 10 µM resveratrol, an inhibitor of CYP1A1 induction, in combination with either 1 or 10 µM 5F-203 showed an ablation of the observed CYP1A1, but not CYP1B1 mRNA induction in parallel with a decreased sensitivity to 5F-203. Fine needle aspirates were obtained from a variety of human tumor xenografts, and treated ex vivo with 1 µM 5F-203 for 24 h. In these samples, induction of CYP1A1 by 5F-203 correlated with in vitro sensitivity (R = 0.711, P < 0.05), and corresponded to in vivo sensitivity in human tumor xenografts. These data are concordant with the idea that toxicity of 5F-203 requires activation by CYP1A1, and therefore induction of CYP1A1 mRNA in response to 5F-203 treatments ex vivo may provide a possible surrogate marker for determination of drug-sensitive tumors in patients.

Key Words: CYP1A1 • CYP1B1 • Surrogate markers • 2-[4-Amino-3-methylphenyl]-5-fluoro-benzothiazole


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
A preclinical drug candidate, 2-(4-amino-3-methylphenyl)benzothiazole (NSC #674495 or DF-203), has been selected from a series of compounds originally submitted by Hutchinson et al. (1–4). Correlative analysis by the COMPARE program (5) did not show significant correlation with any known class of anticancer agent, suggesting a novel mechanism of action for this compound. Analogues of DF-203 have subsequently been synthesized and the current lead compound is a 5-fluoro-benzothiazole (NSC #703786 or 5F-203; 1). 5F-203 correlates significantly with the mean graph fingerprints of DF-203 [Pearson correlation coefficient (PCC) = 0.886, P < 0.0001] and maintains its selectivity against the same cell lines as the parent compound (1).

Activity of these benzothiazoles appears to be mediated by selective metabolism of the drug in tumor cell lines, because only sensitive cell lines have been shown to accumulate and produce the major inactive metabolite 6-hydroxybenzothiazole (2). Moreover, [14C]-labeled benzothiazole accumulated in, and covalently bound to proteins only in sensitive cells (6). The cytochrome P450 enzymes CYP1A1 and CYP1B1 have been reported to be the isoforms responsible for 6-hydroxylation of benzothiazoles (2). CYP1A1 has been identified as a covalently bound protein in sensitive cell lines (7). In addition, recent evidence indicates that exposure of sensitive cells to 5F-203 results in DNA adduct formation (2). It has also been demonstrated that DF-203 increased both CYP1A1 and CYP1B1 mRNA expression along with aryl hydrocarbon recepter (AhR) localization into the nucleus (7) and induced DNA damage and S-phase cell cycle arrest (8) in sensitive cell lines only. Therefore, the current model of 5F-203 activity is that sensitive cell types induce CYP1A1 and CYP1B1 in response to the drug; CYP1A1 and possibly CYP1B1 are responsible for the metabolism of 5F-203 to both inactive metabolites and as yet unidentified active metabolite(s), which covalently modify protein and DNA.

This mechanism implies that only certain patient tumors will be able to metabolize the drug and then experience potential benefit, and that "traditional" early clinical trial design, where all patients with tumors are exposed to drug, may not necessarily be appropriate. To further define the role of CYP1A1 and CYP1B1 in 5F-203's unique response profile, we examined the constitutive and 5F-203-induced expression of CYP1A1 and CYP1B1 in the 60 cell lines contained in the National Cancer Institute's empirical anticancer drug screening cell line panel, along with fine needle aspirates (FNAs) derived from human tumor xenografts. We found that induction of CYP1A1 correlates with cell sensitivity when treated either in vitro or ex vivo from tumor xenografts and therefore induction of CYP1A1 may have a role as a surrogate marker for patient tumor sensitivity to 5F-203.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Drugs and Cell Culture
Both 5F-203 (NSC #703786) and resveratrol were obtained from the drug repository of National Cancer Institute's Developmental Therapeutics Program (Rockville, MD) and were prepared in 100% DMSO at a concentration of 40 mM, aliquoted, and kept frozen at -80°C until required. Cell lines were obtained from the National Cancer Institute's anticancer drug screening cell line panel, National Cancer Institute-Frederick, Frederick, MD and maintained in RPMI 1640 supplemented with 5% fetal bovine serum (FBS) and 2 mM L-glutamine (Bio Whittaker, Walkersville, MD) referred herein as complete media.

Drug Treatment and RNA Isolation for Constitutive and Induced Expression
The 60 cell lines of the National Cancer Institute anticancer drug screen were incubated overnight at 37°C in 96-well microtiter plates in 100 µl complete media then treated with 1.0 µM 5F-203 or complete media for 24 h (100 µl additional volume). Total RNA was isolated using the RNeasy 96 kit (Qiagen, Valencia, CA) and the QIAvac vacuum manifold (Qiagen) and total RNA quantified based on its absorbance at A260 nm and RNA purity was measured by the A260 nm/A280 nm ratio. RNA samples were stored at -70°C until used for reverse transcription (RT)-PCR. Two independent treatments and RNA isolations were made for each of the cell lines. Sensitivity profiles for both DF-203 and 5F-203 were measured in the National Cancer Institute anticancer drug screen (5, 9).

Time Course of CYP1A1 Induction
MCF-7 and MDA-MB-435 cells were incubated overnight at 37°C in 60-mm Petri dishes (5.0 x 106 cells/dish) and treated with 1.0 and 10.0 µM 5F-203 or complete media for 0, 2, 4, 6, 8, 12, and 24 h at which times total RNA was isolated from the samples using the Qiagen mini kit (Qiagen). Total RNA samples were quantitated by measuring absorbance at 260 nm and stored at -70°C until used for measurement of CYP1A1 mRNA expression via real-time RT-PCR.

RT-PCR
The RT-PCR reactions were measured with the ABI Prism 7700 Sequence Detection System using TaqMan one-step RT-PCR master mix reagent kit (Applied Biosystems, Foster City, CA) in 50 µl reactions (10). Primers and probes for CYP1A1 and CYP1B1 were designed with Primer Express software (Applied Biosystems) using the gene bank sequence for human CYP1A1 mRNA (accession number NM_000499: forward primer: GATTGGGCACATGCTGACC, reverse primer: CTGTCAAGGATGAGCCAGCA, probe: FAM-TGGGAAAGAACCCGCACCTGGC-TAMRA) and human CYP1B1 mRNA (accession number NM_000104: forward primer: TTTCGGCTGCCGCTACA, reverse primer: ACTCTTCGTTGTGGCTGAGCA, probe: FAM-ACGACGACCCCGAGTTCCGTGAG-TAMRA). The primers and probe for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were from a GAPDH human control reagent kit (Applied Biosystems). Primer and probe concentrations for CYP1A1 and CYP1B1 were 300 nM and for GAPDH 100 nM. Thermocycler parameters were 30 min at 48°C, 10 min at 95°C and 40 PCR cycles of 15 s at 95°C and 1 min at 60°C. All RNA samples were tested in quadruplicate PCR reactions for both RNA isolations and no template controls, and -RT controls were run for each experiment. Data were analyzed using the comparative CT method (Applied Biosystems, User Bulletin #2, ABI Prism 7700 Sequence Detection System, 1997, Part Number: 4303859). Constitutive expression of CYP1A1 and CYP1B1 was expressed relative to a calibrator cell line (MOLT-4) and induced expression was expressed relative to constitutive levels.

Inhibition of CYP1A1 Induction by Resveratrol
For dose-response analysis of 5F-203/resveratrol drug combinations, MCF-7 (5000 cells/well), TK-10 (10,000 cells/well), IGROV-1 (10,000 cells/well), and MDA-MB-435 (10,000 cells/well) were inoculated onto 96-well microtiter plates in 100 µl of complete media. Twenty-four hours after inoculation, 5F-203 was added into each plate as six serial 10-fold dilutions starting at a high test concentration of 100 µM, followed by addition of either 10 or 100 µM resveratrol. Plates were then incubated for an additional 48 h at 37°C at which time total cellular protein was fixed to the plate with the addition of 50 µl of cold 50% trichloroacetic acid. Plates were then processed using the sulforhodamine B (SRB) protein assay (9). Briefly, cellular protein was stained with a 4% SRB stain (in 1% acetic acid) and unbound stain was rinsed from the plate with a 1% acetic acid solution, plates were then air-dried, and bound SRB was solubilized by the addition of 100 µl of 10 mM Tris. Optical densities were measured at 515 nm and dose-response curves were constructed.

For measurement of CYP1A1 and CYP1B1 mRNA, MCF-7, TK-10, IGROV-1, and MDA-MB-435 cells were inoculated onto six-well tissue culture plates at a density of 5.0 x 106 cells/dish and incubated overnight at 37°C. Cells were then treated with either 1.0 or 10.0 µM 5F-203, 10 µM resveratrol, or a combination of 1.0 or 10.0 µM 5F-203 and 10 µM resveratrol or complete media. Twenty-four hours after drug addition, RNA was isolated using the Qiagen mini kit (Qiagen). Total RNA samples were quantitated and stored at -70°C until used for real-time RT-PCR.

Western Blots
Six drug-sensitive (IGROV-1, OVCAR-4, T-47D, TK-10, OVCAR-5, and ZR-75-1) and six drug-resistant cell lines (BT-549, MDA-MB-231, HCT-116, CAKI-1, RPMI-8226, and MDA-MB-435) were incubated overnight at 37°C in 100-mm Petri dishes, treated with 1 µM 5F-203 (or complete media) for 24 h, lysed, and total cellular protein collected and quantitated by measuring absorbance at 595 nm using the Bio-Rad protein assay (Bio-Rad, Hercules, CA). Twenty-five micrograms of total protein were loaded onto a 10% Tris-glycine gel and electrophoresed at 100 V (constant voltage) for 2.5 h, then electrotransferred for 1 h at 1 A. Blots were blocked overnight in 3% BSA at 4°C, then incubated with primary antibody (diluted in 0.5% BSA) for 1 h at room temperature (CYP1A1 1:1000, Gentest, Wobourn, MA), rinsed with Tris-buffered saline Tween 20 (TBST) and incubated with secondary antibody (antirabbit, 1:50,000, Amersham, Piscataway, NJ) in 0.5% BSA for 0.5 h at room temperature. Bands were developed using enhanced chemoluminescence (ECL, Amersham). Blots were re-blocked and B-actin (primary 1:25,000, secondary 1:50,000, Sigma, St. Louis, MO) was measured as above.

Correlative Analysis
Constitutive and drug-induced expression of CYP1A1 and CYP1B1 in the 60 cell lines were transformed into mean graph patterns (5, 11) by presenting the measured gene expression of each cell line relative to the average expression of 60 cell lines. Cell line responses projecting to the left represent those with lower than average expression, whereas those projecting to the right represent cell lines with higher than average expression. PCC values were calculated between a pattern of benzothiazole toxicity (generated from the average cell line responses to DF-203 and 5F-203) and constitutive or drug-induced gene expression patterns of CYP1A1 and CYP1B1. PCC values were transformed to standard normal z statistics and one-sided P-values were determined from published statistical tables.

Fine Needle Aspirates
Approximately 3–5 x 106 cells were aspirated from 6- to 10-mm-diameter (500 mg) s.c. xenografts of tumor-bearing mice using a 20-gauge needle attached to a 5-cc syringe (collecting cells from the periphery of the xenograft). Following aspiration, the cells were suspended in RPMI 1640 supplemented with 10% FBS. Cell suspensions were incubated for 2 h at 37°C in 60-mm Petri dishes then treated with 1.0 µM 5F-203 or complete media as a control. Twenty-four hours after drug treatment, RNA was isolated from the cells using the Qiagen RNeasy mini kit. RT-PCR was performed to determine CYP1A1 induction as previously described. Where cells from the FNAs could be cultured over 72 h, sensitivity to 5F-203 was measured using the SRB protein assay as previously described.

Xenograft Testing
Xenografts were established by injecting 1 x 107 tumor cells s.c. into the axillary region of 6- to 8-week-old female athymic nude (nu/Ncr) mice. Mice were housed in an AAALAC-accredited facility with food and water provided ad libitum. Tumor growth was monitored with caliper measurements. For drug efficacy studies, tumors were considered sensitive to 5F-203 when the optimal %T/C was 40% or less. The optimal %T/C is defined as the lowest value obtained when the median tumor weight of the test group divided by the median tumor weight of the vehicle control group is expressed as a percentage. The tumor weights are calculated from tumor length and width measurements collected every 3–4 days and converted to weight using the volume formula for a prolate ellipsoid (12).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Induction of CYP1A1 and CYP1B1 Messenger RNA by 5F-203 in 60 Human Tumor Cell Lines
5F-203 has been shown in previous studies to induce CYP1A1 protein in sensitive MCF-7, T-47D, and SKBR3 cell lines but no induction was shown in insensitive cell lines such as MDA-MB-435, PC-3, and DU-145 (2). A time course of CYP1A1 induction in a 5F-203-sensitive cell line (MCF-7) and insensitive cell line (MDA-MB-435) revealed that treatment of cells with 1.0 µM 5F-203 induced CYP1A1 gene expression only in the MCF-7 cells, measurable after 2 h, increased for up to 6–8 h, and then remained at high levels of expression up to 24 h (Fig. 1). Although 10 µM treatment indicated similar results, significant toxicity in terms of loss of cells was observed with this higher drug concentration.



View larger version (10K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Time course of induction of CYP1A1 gene expression in cells treated with 1.0 and 10.0 µM 5F-203. Cell pellets were collected after 2, 4, 6, 8, 12, and 24 h treatment with either 1.0 or 10.0 µM 5F-203. RNA was isolated and real-time PCR performed to measure CYP1A1 expression in drug-treated compared to untreated cells using GAPDH expression as an endogenous control. Points, average fold induction (from two independent treatments) of CYP1A1 in drug-treated cells, showing clear induction in the drug-sensitive MCF-7 cell line only; bars, SD. {diamondsuit} MCF-7 1.0 µM, {blacksquare} MCF-7 10.0 µM, {square} MCF-7 untreated, {blacktriangleup} MDA-MB-435 1.0 µM, • MDA-MB-435 10.0 µM, {circ} MDA-MB-435 untreated control.

 
To determine if induction of CYP1A1 or CYP1B1 gene expression was essential for the specificity of DF-203 and 5F-203 toxicity, 60 cell lines from the National Cancer Institute's empirical drug screen were treated for 24 h with 1.0 µM 5F-203 or complete media as a control. Constitutive and induced mRNA levels of these two genes were measured in control untreated, and drug-treated cells respectively, by real-time RT-PCR. Expression patterns (11) were generated by representing the gene expression from each cell line relative to the average gene expression of all 60 cell lines. Bars projecting to the left represent cells with lower than average expression and those projecting to the right represent cells with higher than average expression. Patterns for constitutive mRNA expression of CYP1A1 and CYP1B1 (Fig. 2, A and C) and drug-induced expression of CYP1A1 and CYP1B1 (Fig. 2, B and D) were correlated with the average sensitivity pattern of DF-203 and 5F-203 (PCC between DF-203 and 5F-203 = 0.886, P < 0.0001; Fig. 2E), where bars projecting to the right represent cells more sensitive than the average cell line and bars projecting to the left represent cells less sensitive than average. These data show that there was a highly significant correlation between drug sensitivity and induction of CYP1A1 mRNA (PCC = 0.752, P < 0.0001). Correlations between drug toxicity and CYP1A1 constitutive gene expression (PCC = 0.083), CYP1B1 constitutive expression (PCC = 0.376), and CYP1B1 drug-induced expression (PCC = 0.438) were lower than that for 5F-203-induced CYP1A1 expression.



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Mean graph representation in 60 human tumor cell lines (average expression from two independent experiments) of CYP1A1 constitutive gene expression (A), CYP1A1 5F-203-induced gene expression (B), CYP1B1 constitutive gene expression (C), CYP1B1 5F-203-induced gene expression (D), and 5F-203/DF-503 cytotoxicity (50% growth inhibitory concentration [GI50]) (E). Constitutive gene expression shows the basal expression of CYP1A1 or CYP1B1 (normalized to GAPDH) and expressed relative to a calibrator cell line. Induced expression is the fold induction of CYP1A1 or CYP1B1 relative to the constitutive expression. Cytotoxicity mean graph shows the averaged GI50 sensitivity of the cell lines following 48 h treatment with 100–0.01 µM 5F-203 or DF-203. To generate the mean graphs, the mean value for gene expression or GI50 across the 60 cell lines was calculated and subtracted from each individual cell line value. Bars projecting to the right indicate higher than average expression or drug/sensitivity and bars projecting to the left indicate lower than average expression/sensitivity. Open bars () show drug-sensitive cell lines (identified by name) based on the data in panel E, and closed bars () show insensitive cell lines. Additional identified cell lines are those shown in the Western blot analysis (Fig. 3). A significant correlation is seen between the drug sensitivity profile (E) and the profile for drug-induced CYP1A1 gene expression (B; PCC = 0.752, P < 0.001). Cell line disease types are lung (LUN), ovarian (OVA), brain (CNS), leukemia (LEU), prostate (PRO), colon (COL), renal (REN), melanoma (MEL), and breast (BRE).

 


View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Induction of CYP1A1 protein in human tumor cell lines, either untreated control (C) or treated with 1 µM 5F-203 for 24 h (T). Lysates were prepared and 50 µg of total protein were subjected to SDS-PAGE/immunoblot assay using a CYP1A1 specific antibody. Antibody detection was by ECL. Induction was seen in 5F-203-sensitive cell lines IGROV-1 (A), OVCAR-4 and T-47D (B), and TK-10 and ZR-75-1 (C), but not in 5F-203-insensitive cell lines.

 
Induction of CYP1A1 Protein in 5F-203-Treated Cells
Immunoblot analysis was performed on six 5F-203-sensitive cell lines and six 5F-203-resistant cell lines for protein expression of CYP1A1 (Fig. 3). All 5F-203-sensitive cell lines showed some increase in CYP1A1 protein expression after treatment with 1.0 µM 5F-203 for 24 h and induction of CYP1A1 protein levels correlated with cell line sensitivity (R = 0.698, P < 0.01).

Inhibition of CYP1A1 Messenger RNA Expression by Resveratrol
Resveratrol has been shown to decrease both basal and induced expression of CYP1A1 mRNA (13). To elucidate the requirement for CYP1A1 induction as a prerequisite for 5F-203 sensitivity, one 5F-203-resistant cell line (MDA-MB-435) and three sensitive cell lines (MCF-7, TK-10, IGROV-1) were treated with 5F-203 (100–0.001 µM) alone or in combination with either 10 or 100 µM resveratrol. Dose-response analysis of the drug combinations showed a marked decrease in sensitivity to 5F-203 in sensitive cell lines treated with both 10 and 100 µM resveratrol (Fig. 4). In the presence of 10 µM resveratrol and 10 µM 5F-203, there was an ablation of 5F-203 toxicity in all the sensitive cell lines while the insensitive cell line demonstrated no changes in 5F-203 response. To measure CYP1A1 and CYP1B1 mRNA gene expression changes, cell lines were treated in parallel with either 1.0 or 10.0 µM 5F-203 alone, or in combination with 10 µM resveratrol for 24 h. Resveratrol alone had no effect on CYP1A1 expression in any of the cell lines. 5F-203 at both 1.0 and 10.0 µM resulted in a significant induction of CYP1A1 gene expression compared to control in the three 5F-203-sensitive cell lines, but not in the resistant cell line. In contrast, 5F-203 at both 1.0 and 10.0 µM in combination with 10 µM resveratrol showed a significant inhibition of induced and constitutive gene expression of CYP1A1 in the 5F-203-sensitive cell lines (Fig. 5). Resveratrol alone or in combination with 5F-203 had no effect on CYP1B1 expression and did not alter expression changes induced by 5F-203 in sensitive or resistant cell lines.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. Four cell lines were treated with 100–0.001 µM of 5F-203 either alone ({diamondsuit}) or in combination with 10 µM resveratrol ({blacksquare}), or 100 µM resveratrol ({blacktriangleup}) for 48 h after which drug sensitivity was assessed using the SRB protein assay. Toxicity of the 5F-203 was abrogated in three drug-sensitive cell lines [IGROV-1 (B), MCF-7 (C), and TK-10 (D)], in the presence of resveratrol, but not altered in the insensitive line, MDA-MB-435 (A).

 


View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. Induction of CYP1A1 (A) and CYP1B1 (B) gene expression in cell lines treated with either 1.0 or 10.0 µM 5F-203 alone, or in combination with 10 µM resveratrol for 24 h. RNA was isolated and real-time PCR performed to measure CYP1A1 or CYP1B1 induction (±SD of triplicate measurements) in drug-treated, compared to untreated, cells using GAPDH expression as an endogenous control. Only CYP1A1, not CYP1B1, induction was consistently inhibited by resveratrol. , Resveratrol alone; , 1.0 µM 5F-203; , 1.0 µM 5F-203 + 10.0 µM resveratrol; , 10.0 µM 5F-203; , 10.0 µM 5F-203 + 10.0 µM resveratrol.

 
Efficacy of 5F-203 in Human Tumor Xenografts
When the parent benzothiazole (NSC #674495) was tested in human tumor xenografts, both MCF-7 and ZR-75-1 had an optimal T/C of less than 40% on a dose schedule of 7.5 mg/kg i.p. administered every 4 days over three courses, meeting the required criteria to be considered active. A xenograft of OVCAR-3 also demonstrated in vivo sensitivity at a dose schedule of 20 mg/kg p.o. administered every day for 5 days. Other xenografts of drug-insensitive cell lines (LOX-IMVI, MDA-MB-435) were not found to be sensitive to this drug.

Induction of CYP1A1 in FNAs
To determine if CYP1A1 could be used as a marker for in vivo tumor sensitivity to 5F-203, FNAs were taken from human tumor xenografts grown to 500 mg tumors in nude mice. The FNAs were treated ex vivo with 1.0 µM 5F-203 or complete media for 24 h after which CYP1A1 mRNA expression levels were measured and induction of CYP1A1 was expressed relative to control (Fig. 6). Of the nine FNAs analyzed, all cell lines sensitive to 5F-203 in vitro demonstrated an induction of CYP1A1 that was significant compared to the insensitive cell line MDA-MB-435. The induction of CYP1A1 in the FNA samples significantly correlated with in vitro sensitivity (R = 0.755, P < 0.01). Figure 7 shows the toxicity of 5F-203 to four FNA samples that could be cultured for at least 72 h following aspiration. Compared to in vitro data from these cell lines, an increase in overall drug sensitivity was observed under these ex vivo/in vitro conditions, presumably due to the trauma of fine needle aspiration and the altered environment. However, rank order 5F-203 sensitivity was maintained (MCF-7 > OVCAR-5 > MDA-MB-435 = MDA-MB-231), and correlated with the induction of CYP1A1 measured in aliquots of the same samples (Fig. 6).



View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 6. Induction of CYP1A1 gene expression in FNAs collected from human tumor xenografts and treated ex vivo with 1.0 µM 5F-203 for 24 h. Following 24 h treatment, RNA was isolated from cells and real-time PCR was performed to measure CYP1A1 induction in drug-treated, compared to untreated, cells using GAPDH expression as an endogenous control. All in vitro sensitive cell lines (), and in vivo sensitive cell lines (*) demonstrated statistically significant (P < 0.01) induction of CYP1A1, while the 5F-203-resistant cell lines HCT-15, MDA-MB-231, and MDA-MB-435 demonstrated no significant induction of CYP1A1.

 


View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 7. 5F-203 sensitivity of in vitro cultured cells from FNAs taken from human tumor xenografts. Aspirated cells were cultured in 96-well microtiter plates in RPMI 1640 plus 10% FBS for 24 h then treated with 100–0.001 µM 5F-203 for 48 h. Cellular protein was measured using the SRB protein assay and dose-response curves were generated. Cell lines: {diamondsuit} MDA-MB-435; • MDA-MB-231/ATCC; {blacktriangleup} OVCAR-5; and {blacksquare} MCF-7.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Patients have often been treated with toxic drugs without any definitive understanding of whether the individual's tumors were sensitive to the drug. The era of molecularly targeted drug development has opened the possibility that patients could be screened for expression of a particular drug target to enhance the likelihood that the tumor would respond favorably to the drug. A specific target of the currently preclinical drug 5F-203 has not been established, but the determination of induced CYP1A1 gene expression, a molecularly defined potential surrogate marker of patient sensitivity, might allow for the identification of a population of patients that would respond favorably to 5F-203 chemotherapy, therefore sparing patients with intrinsically resistant tumors unnecessary drug treatment and associated toxicities. This thinking is formally analogous to the use of estrogen and progesterone receptor expression to select the best cancer patients with a higher likelihood of responding to hormonal therapies but differs in that a dynamic response of the tumor cells to the drug is scored.

Cytochrome P450 plays an important role in drug, carcinogen, and steroid hormone metabolism by oxygenating a broad spectrum of lipophilic substrates, which may themselves have biological activity (14). CYP1A1 and CYP1B1 share overlapping substrate specificities and have been implicated as playing a pivotal role in cell line sensitivity to the benzothiazole analogue series through metabolism to an active species which ultimately causes DNA damage. Only 5F-203-sensitive cell lines have shown drug-induced levels of CYP1A1 and CYP1B1 activity and proteins (1), activation of the AhR pathway (7), accumulation of metabolites, and formation of DNA adducts (15).

This study has correlated the induced, as opposed to constitutive CYP1A1 and CYP1B1 gene expression, to the cytotoxicity of 5F-203 treatment. There is a highly significant correlation between induced but not basal expression of CYP1A1 mRNA and sensitivity to 5F-203/DF-203 in a diverse panel of human tumor cell lines. All cell lines exquisitely sensitive to 5F-203/DF203 (MCF-7, T-47D, TK-10, IGROV-1, OVCAR-5, and ZR-75-1) showed induction of CYP1A1 at levels greater than 20-fold. However, three additional cell lines showed relatively modest induction of CYP1A1 following treatment with 5F-203, with no apparent sensitivity to the toxicity of the drug. This indicates that, in some cell lines, additional factors may be important in defining toxicity to 5F-203. There are a variety of possibilities including posttranscriptional regulation of the protein, or generation of a non-functional protein, or the toxic metabolite if produced cannot bind to the target, or damage is efficiently repaired. Data for the HCT-116 cell line illustrate this point as it is insensitive to the drug, and although there was an increase in gene expression levels (Fig. 2), there was no measurable increase in protein expression (Fig. 3). Furthermore, RPMI-8226, a drug-insensitive cell line, has high constitutive expression of the CYP1A1 gene transcript which is not altered by 5F-203 treatment, but there was no measurable protein expressed under either situation. However, despite these inconsistencies, the correlation observed between gene expression induction and toxicity remains a persuasive indicator of sensitivity. Moreover, increased protein levels of CYP1A1 correlated with increased gene expression levels in a subset of cell lines, indicating that induction of gene expression resulted overall in an increase in functional protein, consistent with published data (2, 7, 14).

To further explore the relationship of CYP1A1 to 5F-203 activity, we used resveratrol which has been reported to decrease basal and induced CYP1A1 mRNA and protein levels both in vitro and in vivo via an AhR-independent posttranscriptional pathway in MCF-7 and T-47D breast cancer cells (13). Using resveratrol as a tool to resolve whether 5F-203 toxicity is dependent on CYP1A1 induction, sensitive cell lines (MCF-7, TK-10, and IGROV-1) treated with a combination of resveratrol and 5F-203 demonstrated a dramatic decrease in drug-induced CYP1A1 expression with a corresponding decrease in cytotoxicity. In contrast, no changes in CYP1A1 expression, or drug sensitivity were measured in the resistant MDA-MB-435 cell line. Moreover, no changes in 5F-203-induced CYP1B1 expression were observed when cells were co-treated with resveratrol and 5F-203 in either the sensitive or resistant cell lines. These findings suggest that metabolism by CYP1A1, rather than CYP1B1, plays a critical role in determining sensitivity to 5F-203. Moreover, this supports the hypothesis that induction of CYP1A1 gene expression might act as a surrogate marker of tumor sensitivity.

FNAs have proven to be an effective, relatively noninvasive means to collect samples from tumors. FNAs have been successfully collected from primary breast cancers (16), malignant melanomas (17), masses of the head and neck (18), and from internal organs such as liver (19) and kidney (20). To validate the in vitro finding that gene expression changes can be used as a measure of drug sensitivity, nine fine needles aspirates of known differential SF-203 susceptibility were taken from human tumor xenografts grown in nude mice. The FNAs were subjected to 24 h treatment ex vivo with 1 µM 5F-203, the RNA was extracted, and induction of CYP1A1 was measured and compared to the untreated control. The methodology employed was derived primarily to be amenable to conversion to a diagnostic assay for human specimen use. None of the insensitive tumors showed any increase in CYP1A1 expression, while the in vitro sensitive tumors showed a >5-fold induction of CYP1A1 and the magnitude of induction tended to be representative of the level of sensitivity of the tumor (Fig. 6). Two of the in vitro sensitive tumors, MCF-7 and ZR-75-1, had been tested as xenograft models, and under optimized schedules of 7.5 mg/kg i.p. q4d x 3, shown to be sensitive. A xenograft model of IGROV-1, another in vitro sensitive tumor, has previously been shown to be sensitive to the lysylamide 5F-203 prodrug (21) and to 5F-203 in vivo.2 OVCAR-3, a 5F-203-insensitive cell line with no in vitro induction of CYP1A1, was also found to be sensitive when treated with the schedule 20 mg/kg p.o. administered every day for 5 days confirming previously published in vivo data (21). The FNA sample taken from this sensitive xenograft showed a 4x induction of CYP1A1 when treated with 5F-203 ex vivo, in contrast to the lack of gene induction from the in vitro sample. This result also suggests the possibility that our in vitro data might underestimate the proportion of tumors sensitive to 5F-203 toxicity in vivo, but underscore the value of CYP1A1 gene induction in predicting the potential value of 5F-203 treatment. Moreover, the relative, rank order in vitro drug sensitivity of these cells was maintained, following incubation of four differentially sensitive FNAs with 5F-203 for 48 h (Fig. 7).

In summary, we have demonstrated that in a series of not only in vitro cell lines but also cells treated ex vivo from xenografts, induced, but not basal CYP1A1 gene expression, is a reliable predictor of sensitivity both in vitro and in vivo. Numerous questions remain including the nature of the toxic metabolite(s) produced by CYP1A1, how they are detoxified or further activated, and the basis for differential activation of the AhR pathway in "sensitive" as opposed to "resistant" cell types. Nonetheless, our results have charted a path for potential further development of 5F-203 that may minimize drug exposure of patients with tumors unlikely to respond to the agent. In addition, the assay described here could be the basis for defining a pharmacodynamic effect after drug exposure in vivo, and then defining a biologically effective dose as opposed to dose escalation beyond that necessary.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Grant support: This project has been funded, in whole or in part, with federal funds from the National Cancer Institute, National Institutes of Health, under Contract No. NO1-CO-12400. Note: The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organization imply endorsement by the U.S. Government.

2 Tracy D. Bradshaw, University of Nottingham, United Kingdom, personal communication. Back

Received 7/ 1/03; revised 9/ 3/03; accepted 9/10/03.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hutchinson, I., Chua, M. S., Browne, H. L., Trapani, V., Bradshaw, T. D., Westwell, A. D., and Stevens, M. F. Antitumor benzothiazoles. 14. Synthesis and in vitro biological properties of fluorinated 2-(4-aminophenyl)benzothiazoles. J. Med. Chem., 244: 1446–1455, 2001.
  2. Chua, M. S., Kashiyama, E., Bradshaw, T. D., Stinson, S. F., Brantley, E., Sausville, E. A., and Stevens, M. F. Role of CYP1A1 in modulation of antitumor properties of the novel agent 2-(4-amino-3-methylphenyl)benzothiazole (DF 203, NSC 674495) in human breast cancer cells. Cancer Res., 60: 5196–5203, 2000.[Abstract/Free Full Text]
  3. Bradshaw, T., Leong, C. O., Gaskell, M., Martin, E., Heydon, R., Farmer, P., Bibby, M., Double, J., Cooper, P., and Stevens, M. Potent, selective antitumor 2-(4-aminophenyl)benzothiazoles generate DNA adducts in sensitive tumors. Proc. Am. Assoc. Cancer Res., 43: A4757, 2002.
  4. Bradshaw, T., Bibby, M., Double, J., Fichtner, I., Cooper, P., Alley, M., Donohue, S., Stinson, S., Tomaszewjski, J., Sausville, E., and Stevens, M. Preclinical evaluation of amino acid prodrugs of novel antitumor 2-(4-amino-3-methylphenyl)benzothiazoles. Mol. Cancer Ther., 1: 239–246, 2002.[Abstract/Free Full Text]
  5. Paull, K. D., Shoemaker, R. H., Hodes, L., Monks, A., Scudiero, D., Rubinstein, L., Plowman, J., and Boyd, M. R. Display and analysis of patterns of differential activity of drugs against human tumor cell lines: development of mean graph and COMPARE algorithm. J. Natl. Cancer Inst., 81: 1088–1092, 1989.[Abstract/Free Full Text]
  6. Brantley, E., Trapani, V., Stinson, S., and Stevens, M. F. Metabolism and subcellular binding of novel fluorinated 2-(4-amino-3-methylphenyl)benzothiazoles in human cancer cells. Proc. Am. Assoc. Cancer Res., 42: A1755, 2001.
  7. Loaiza-Perez, A. I., Trapani, V., Hose, C., Singh, S. S., Trepel, J. B., Stevens, M. F., Bradshaw, T. D., and Sausville, E. A. Aryl hydrocarbon receptor mediates sensitivity of MCF-7 breast cancer cells to antitumor agent 2-(4-amino-3-methylphenyl) benzothiazole. Mol. Pharmacol., 61: 13–19, 2002.[Abstract/Free Full Text]
  8. Trapani, V., Patel, V., Leong, O. C., Ciolino, H., Yeh, G., Hose, C., Trepel, J., Bradshaw, T., Stevens, M., Sausville, E., and Loaiza-Perez, A. Benzothiazoles mediate MCF-7 cell DNA damage and S phase cell cycle arrest through the aryl hydrocarbon receptor. Proc. Am. Assoc. Cancer Res., 43: A1921, 2002.
  9. Monks, A., Scudiero, D., Skehan, P., Shoemaker, R., Paull, K., Vistica, D., Hose, C., Langley, J., Cronise, P., Vaigro-Wolff, A., Gray-Goodrich, M., Campbell, H., Mayo, J., and Boyd, M. Feasibility of a high-flux anticancer drug screen using a diverse panel of cultured human tumor cell lines. J. Natl. Cancer Inst., 83: 757–766, 1991.[Abstract/Free Full Text]
  10. Bustin, S. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol., 25: 169–193, 2000.[Abstract]
  11. Zaharevitz, D. W., Holbeck, S. L., Bowerman, C., and Svetlik, P. A. COMPARE: a web accessible tool for investigating mechanisms of cell growth inhibition. J. Mol. Graph. Model., 20: 297–303, 2002.[CrossRef][Medline]
  12. Plowman, J., Dykes, D. J., Hollingshead, M., Simpson-Herren, L., and Alley, M. C. Human tumor xenograft models in NCI drug development. In: B. Teicher (ed.), Anticancer Drug Development Guide: Preclinical Screening, Clinical Trials and Approval, pp. 101–121. Totowa, NJ: Humana Press Inc., 1997.
  13. Lee, J. and Safe, S. Involvement of a post-transcriptional mechanism in the inhibition of CYP1A1 expression by resveratrol in breast cancer cells. Biochem. Pharmacol., 62: 1113–1124, 2001.[CrossRef][Medline]
  14. Whitlock, J. P. Induction of cytochrome P4501A1. Annu. Rev. Pharmacol. Toxicol., 39: 103–125, 1999.[CrossRef][Medline]
  15. Stevens, M. F., Heyden, R. T., Martin, E. A., Farmer, P. B., Bradshaw, T. D., Hutchinson, I., Westwell, A. D., Browne, H. L., and Trapani, V. Induction of CYP1A1 by 2-(4-aminophenyl) benzothiazole leads to DNA adducts in sensitive tumor cells. Proc. Am. Assoc. Cancer Res., 42: A1754, 2001.
  16. Wu, J. T., Zhang, P., and Bentz, J. S. Quantification of HER2 oncoprotein in fine-needle aspirates of the breast. Ann. Clin. Lab. Sci., 30: 49–56, 2000.[Abstract]
  17. Creager, A. J., Pitman, M. B., and Geisinger, K. R. Cytologic features of clear cell sarcoma (malignant melanoma) of soft parts: a study of fine-needle aspirates and exfoliative specimens. Am. J. Clin. Pathol., 117: 217–224, 1998.
  18. Stanley, M. W. Selected problems in fine needle aspiration of head and neck masses. Mod. Pathol., 15: 342–350, 2002.[CrossRef][Medline]
  19. Hertz, G., Reddy, V. B., Green, L., Spitz, D., Massarani-Wafai, R., Selvaggi, S. M., Kluskens, L., and Gattuso, P. Fine-needle aspiration biopsy of the liver: a multicenter study of 602 radiologically guided FNA. Diagn. Cytopathol., 23: 326–328, 2000.[CrossRef][Medline]
  20. Nayar, R., Bourtsos, E., and DeFrias, D. V. Hyaline globules in renal cell carcinoma and hepatocellular carcinoma. A clue or a diagnostic pitfall on fine-needle aspiration? Am. J. Clin. Pathol., 114: 576–582, 2000.[CrossRef][Medline]
  21. Bradshaw, T., Shi, D., Schultz, R., Paull, K., Kelland, L., Wilson, A., Garner, C., Fiebig, H., Wrigley, S., and Stevens, M. Influence of a 2-(4-aminophenyl)benzothiazoles on growth of human ovarian carcinoma cells in vitro and in vivo. Br. J. Cancer, 78: 421–429, 1998.[Medline]



This article has been cited by other articles:


Home page
 Mol. Pharmacol.Home page
A. Wallqvist, J. Connelly, E. A. Sausville, D. G. Covell, and A. Monks
Differential Gene Expression as a Potential Classifier of 2-(4-Amino-3-methylphenyl)-5-fluorobenzothiazole-Sensitive and -Insensitive Cell Lines
Mol. Pharmacol., March 1, 2006; 69(3): 737 - 748.
[Abstract] [Full Text] [PDF]

Home page
 Drug Metab. Dispos.Home page
E. Brantley, V. Trapani, M. C. Alley, C. D. Hose, T. D. Bradshaw, M. F. G. Stevens, E. A. Sausville, and S. F. Stinson
FLUORINATED 2-(4-AMINO-3-METHYLPHENYL)BENZOTHIAZOLES INDUCE CYP1A1 EXPRESSION, BECOME METABOLIZED, AND BIND TO MACROMOLECULES IN SENSITIVE HUMAN CANCER CELLS
Drug Metab. Dispos., December 1, 2004; 32(12): 1392 - 1401.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hose, C. D.
Right arrow Articles by Monks, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hose, C. D.
Right arrow Articles by Monks, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online